Description :
From Genome Similarity Track
Location :
contig_2:14076- 16708
Transcript NameFunction/comments
g535.t1hypothetical protein

Sequence
2632 bases(100 bases per row)
TCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGACACTCAGTGTCTCGACGGGCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTG
TAGCGTCTCAGTCCCTGACCGAGACTTGCGCAGCTTTGCTCGCTTGCGCCGTTCACTTCTCGTGCGGAACCCGGCTCCGCGAGTTTCTTCTTGTCCAGGC
CCGGCCGTGGACAGTTGTTCCTTGTACTCACCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCTCTTCGTCGTGCAGTC
CGGCTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGCCTTCTTTACC
TGAACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTACCTGTCGACACGACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCC
GATTGAATCAGGCCCTGCTGATTCGGTTCACATCTTCTCCCAACGACTCTCGCAGTCGTTGGCGTTCGTTTGGGGTGATCGGAGACAGCCGCATTCCGCG
CTGTCTCTAGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCCCTCTCTGTCGCGCTGCTGCTGCTGCTGCTCCCGAAGCG
CACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCGAGGACGATA
AGCTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATA
GACTTCGAGGTGTTTTCACTTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGA
CCTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTGGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCAAT
GCAGCGTGTCCGATGTCGACACGCTCGACCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTCTAGGTTTTTGATAGTCCGTGACGATATCCAGT
ATCACCACGACGGCTCTTCGCCGCGTGCACAGGTGCTGTGCACTCGCGAGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCA
CGACGCTGCTGGGAACCAGCAGCCGTAGGTACATTGGTTTGGGACCTCCCGATGGCCTTACCACCGGTCGTGGCATCAGCCGCGGGGCGTTCACATGCAG
TTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCA
TCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCGATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCAC
GCACGTCATACTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTC
TTCGTACGTGCTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGACATGACATGGCGAACACAACCTTCGAC
AACGGGTCGACGATACGTCGAGTCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCTACGTAACTGCTTACGTGGA
GTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGTGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTG
TTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGG
TGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCAAGGGCAGGTTCTCAGCCCCGCGTTCGTATT
CCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCAC
GTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTG
CCAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTA
TTAAATGACTCTCATTAGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGGGTGGTCACCTGAATGTATC
CCTTAGTGCATGTTGCACTAAGGTAGGAGGTG