Description :
From Genome Similarity Track
Location :
Scaffold_15:140747- 143450
Transcript NameFunction/comments
Phyin_T30-4PITG_09422Putative uncharacterized protein

Sequence
2703 bases(100 bases per row)
ATTAAGCTCGTACATCTTCGTGAGCGTCTTGAGCTTGAAATCCTTGTCACGATAGCGTGAGCGGGTACGCTCCTTGAAGACTTGCCAAGTTAGAGGGGTT
GTCCCTTGCAAAAGCTTGACATTTCTGTACCAGGCTGGCGCATCAACGCCAAGATTGTCGGAGACCATGTCCGCGAAATTCGATGAGTTATTATGCATTT
CTTCTTGGAACTCCGTATAATATCTCTACCTTCTACGTGTATACCTGCTAAATCCCCTATTGAAGATCCACAGCTCAAGGTCGTCGTCGTCACTACTCTC
GTAGCGCGGGGGATCCGATTTCTTCCGTGTCGGCCTGGGGCGTGACTGAGCTTGTAAGATTTGTTCTTGAGTTTACGCCGTCTGGGCCAGCATTTGGCTC
ATTTGCGTTGACTGCTGCTGCGTGGTTTGGAGTGCAAACTGCAGCATCTGCGCCAGCATGTCTGGTGTAACGGTAGATTGCACCGTCGAACCTTGCGTCG
CGGGCCCTGGTGCTTGTGGAGCGGACTATGCGGCTCCTGCTGTCGTCTGGGGAGGAGCTTGGGCAGTCGGTGGCACGTCCCATCTGGTTCCTTAGGGATT
AGTTCGCGGGTGTTGATGCGGGCGGTCTTCAGAAGTTTCCGAATCCATCACTGACGGCAGTGTTCGCCTAATAGTTAATTACTGTCATGAACTCCGCCGA
TTTTGGAGCTCGGTTGATCCTTAGGTGGCGAGTTTAAGGACTAATAGATTCAATGGCCTTGCTCGCATCTTGCTAGTTGCGGCTACTATTAGGAGTTCCT
TGGAACTTGGGTGAAGAGACTGGCTGATGTTGCGGATACTGGCTGGAAGTTGCAGGTAGCCGCTGACTCAGAAATAATTCACTATGGCTGAGTCATAGGT
GCTGTCACACTTTAAGAACGATACCTTAGCCGATGCAAAGGTTTAACCTTTTTGATCCCCATGCATTCCCTATTAAAACTTTCGATACTTAAAGCGATGC
ATAGCGATTCCAATCTATACTTTCACGGACGTTTCTAGTGGTTATCCTGATCTCCTCATACAAGATTCCTTAGACTGGCTACCGTCGACGACATCCAGTA
GCTTCCCTACGAGCGAAAACCTTAACAACTCAGCCCCTGGATACAATAACCTGTTCGCAAGATCAAATGTGAAGGCTGCTAAGATAGAAAAGAAACGCAG
CTGATAAGCCAGGTATTACCTATTGAAATTTATATTCAATTTTAAAAATTTGGCAGTCTCTATAGTACTATTTACTGCTGGTTTGACTGTGGTGAGTGAA
TGGTCCATTTTTATGGTACATCCAGCGATAGGAATCCCCTTAAATAGGCATAAATAGCAGTCTCCCGACGCTATGACTACCGAGGGGGTTGTCTGCTTAT
AAGCACCGTACTACGTAATCCTTCTGGTGAGGTGCTTGGCTCGGACATGTTAGTAAGGACGCAAATAGCTCACTAGATGCACGAGATGCTAAGGAACATT
TACGTAGGCTCCTTGTTCTCTTTTGGTGCCAACTCGAGGAGTTTCGCCAATTTAAATGGCATGTTAAAATAATCTGGTCCAACGTTCAATGACGAGTACT
TAAGTACATGTACTGTACATGTACAGTAGTAAGTTGTGTGTGACCCAGCGTGGGAAGGCCAGTTGAAGCGAAAGCCAGATAATCAGGCGATATATTGTCT
AAGCTCGCCACAGCAGCTGGACTCGGCACGTCGACCATGATCTGCTGCGGATTCCTGACTCAATTCGAGTCTTTCATCTCGCGAGCTGACCTGGCTAAAG
TGCCGATTTATGCGCGAGGAAGCATGTCCACCAAGAGCGATGGCGGTTGAGACCTACGTGGCTGAATTTTCGTCTCTCCACAGTCGATTCCGAGCACTGC
TGAGTATGCACCACCGGCGTACGGAAGCAAGCATAGTTCTGAGTGACGCGAGTCGGACGTCACACGTCAGTGAGCGCTTCTCGAACCCTTTTGCGTCGCT
GTCGCTGTCTACCGAGGCGGTGGCGGGGCTCGAGACATTGGCACAAACGCTCGTGGCACGGAACATCGAGGCGTACGAACGACATTTGCATGATAATGGC
CACAGTAACAATGTGGACAAGGCGCGTTGGAAACTTATGTACGAACAGGGGGGACTGCGGTCGTACGCAGAACGCAGCACCACTCAGTCATTTGGTTTCG
GAGCAGCAATGGGAGCGGCTGCGGGGCATTTAGACCGACGAGCTCCCGTCTTCACACAGTCGTCGACGAGCACTATACCGTCGGTTTTAGTGGTCGGAGC
GATCGAAGGAGAACTGGACGATACGATGTACGGATTCATGTGTCCGACACTGGATCAGATGCGCGTCAAGACTTCTTACGTGCAAGACGGTCTTGTGCGT
GGCAGTGTGCTGGCTACACTTGTATCTCCAACTGTGGACGACCCGTTCACTTCGGTGGTCGTCAAGTGGATGGAAAAAGGTCAATCGAAACATGCTCGAG
CGATGGTCAAGAACCGAGACTACGTTTATCTCGAGGCTACAGGTGTCGACTACCTTCGCAACGGAGAGCGAGTGGGCTACCAGATTGTGCACTCGATCCA
ATTCCCGGAGACCCCAGAGCGTTCATCAGCAATACGAGGCAATATGTCCATCTGCGCCTTCTACAGACAGAAGAACAGCGACGAAACGGATGTCTACGTC
AAA