Description :
From Genome Similarity Track
Location :
Scaffold_3:1407206- 1416221
Transcript NameFunction/comments
Phyin_T30-4PITG_02315Putative uncharacterized protein

Sequence
9015 bases(100 bases per row)
CAACCCGTATGGCTTTTTCCCATTTTGACCACTGAGGGGAGCGCCTCGCTTCCTCCAATGTCAGTGGTTCCTGGATCACTTCCGTCATGGCTAAGAAAGC
GGCTCCAATGTTACGGCTGGATATCCGCTCCGATCGTCTCCGCCTGGTTAAATCTGTAGCCCCATTGAGTTCCTCGACAAGTGCCGTTGTATATGAAGCT
GCGTTTCTTTCCCGTGTTCGGTCGTCCTCGGTGGGAGCGGATGTCCTATCCGTTGGTCTTACCCGCATTGAGTCGCCGCTGGTTGTGGTTGAGAACTGTT
CTTGTAGAGGGATCATTGGAACACCTGGGTACTGTGCTCTTGGGTGTTTCAACGGTGAACCCAGGAACTTAACGTCGCACGTATTCACAATTCTTGCTCC
ACCTTCTCTCACGTATACAAAGTAACCCTTGCGTTGTTCATCATGCCCCACGAATGCTCCCCTTTGGCCTACTGGTCGAAACTTGAACAAAGTGCTGCGC
TTTCCGGGCGGTAGAAGCACTGTAACGCTTTCTCCAAAGGTGTGAGAGTCCGACAGGTCCGGCATTTTTCCATGGTACTTAGCGTAGGGCATTGTCGATG
GTTCGCTGCGTGAAGTTACTCGGTTTCTCATGTATGCAGCAGCTCGGACAGCGTACTCCCATAGGTTGTGGGGTAAACCAGCTTGGATCAACATTGTCCG
TGCCGCCTCGATGAGTGTTCGGTTTGTTCTTTCCACTACACCATTCTGGTAGTGTACGTCGGGCTCAGAAATTTGTCGTTCCAGGCCTGCTTCATCACAT
AGAGTATTAAACTCCTCGTTGATGAATTCCCCTCCATTGTCCGTTCGCAGAACACGGATTTGCCTTGAGTCTTCACGGTTTTTAATCATAAGTAGGAACT
TTCTAAAGCACCCCACAGCTTCATCCTTCGTCTTGATAAAGTACACGTGAGTATAGTTCAGCCACTTGATTACCAGCATGTAGTGGTTCCCATGTATGCT
TCGCTGGTACTTCCCTGCAAGGTCTGCATGGCAAGCTAGATCCTTCTCTTCTTGAGATCTTGTACTCCGACGAGGTGCCGGGCGACTGGATATCTTGCCG
AGTGTACAGTCTTCACATGGATGGTCCGGGATTTTTCTGGAGCCGATAATCTTCAGACCTTTTACTAACCCACTCCTTTCAAGCTCAATAACGCCTTGGT
AGTGTAAATGCCCAAGTCGTCTGTGCCAGTCCTCAAGTGAGTTTGGGTCGCTGAAGACGTCGTTGCCGCCGCCACACCATCTTCTGCACTCAATCTGGTA
TTACTTTCTTCTTGGTAGCCATAAACTCCATTAATCATCTTTCCTCGGAAGAGCGGAGGGCCGTAGACTACACACCCATCTTCAGTAAAGTCACACTTGA
AGCCACGCTGAGATAGTTTCGATACTGAAAGTAGGGTTTTCTCTAGACCTGGTATAAACACTACTTCGTCAATTTTGGTCCCTTTGGTCCCAAATAAGAC
CAGTGAGCCCCATTGATCACCTTTCATGACATGCCCATCCGGAAGTTCCACCTCGTGAGTTGCACATTGCTGTAGATTAGTCAGCAGCTTCGCTTCCCCA
GTCATGTGGTGAGAAGCTGCCGAGTCAATGTACAGCGGAAACTTTTGAGTTCCAGGGTCAAACGGAAATAACTCGGTGTCCGTCAACACCCCGTGTCTTC
AATCATGGTTTTCGTTTTGTTCGCCTTGAACTTCACGGCTACGGGCTTGCTGGGCGACATGACGATCGTGGTAGTTTGTCGTGTAACCTCGTTCATTGCA
TGTCTTGCACAAAGCGTCTGAGAAGTCCCAACGGGGCCTAGGGGCCTTGGCAGTAGTAGCTGAAGCGCTGCCACTAATTCGGGGTTTCTTGTCACTGCCG
TCTCGGCTAAAATCTTCGCTGCGTCGCTTGTTTGGGTTAATTTTTCCATCACTTTTGGCTAGTTTGGTCAGTAGGACTACTGCGCTTTCAAGTTCTCCGG
TAGCGTCCTCCGCTTCTTGATCAAGTTTGGCTTCTAGATCAACACGGAAGCGAGGGTAAGCATGGTTGATGAAAGTACTCAGCGCCTGCTGCTCAGTATA
CGAGTTGGCTTTGCCACGATTCAGCCCTGCTGCAATCTGGGAGAGTCGGTGAGCATAGGTAGCATATGTTTCCTGGGGAAATTTGCGTGTGTTCGCCAGA
GTGACTGCAATCGTCTGCACCGGGAGCTTACACCGGAAGTTCTCCATGAACTTGTTCGCGAGGTCACAGAAAGAGTCCTTCGGAAGGTTAGAGCTGTTGC
GGTAGTACCAGGTACCAGCTTCACTCGTGAGTCGGGAGGCAAGAACACCGCACTTCACCGTTTCCGGCCACTTTCGCTCCGTGAGTGTCTCTGCCAGGTG
TATCTGTACTTTGAGTCGTTCCAACCAATCATAAGCGCCAGGGTCTATGAATCCATCCTTGGTCGATCCATCAAAGGGCTTAATAGTGATCAATTTGAGG
TCTATCTTCGTTCTTGTCGCGTGTGTCCCCACTGCTCCACTTTTAGTCGTTGGAGCAGGCTCATCTTCCACTTGTTCAAAGTCTGAATCATCGTTTGAAG
ACATGGTAGAAAGGAAATCGAGTCTTGCGGCTGTTAACCTGTTAGATTTCAGGAAAATCAAAGAATGAATTAGATGATTTAACTGCGCGATCCAGAGGGA
GTGGGTACCTATCTAGCGTCATCAGAGGTACTACCGTGATTTCTCCTTTTTGTGTCATCAGTTGAGTTGACCAGTTACAACAATGACAAGCCGAGGGTTA
CCCTGCCGTAAACAGCGTGAAGTTGTGCAAGAAGTGCATGTTCAGCATCCGCCAGGAGCGCAAGGGAACGATGAGAGAGGATACGAACTTCTACGCTGCT
CTTACCATCATCAAACAGTTCCCTTTGGTACTGCAGGGCTCGCTGGCCGTCAATATTGGACTGAGGCCGGGTTCGATGCTTGTATTATTCCCAGGTGGGC
GATACGTAGCCGACATGAGCTGCTTAACAACGCAGAAAGAGGAGGAGCTAAAGAGGGCGATATCGAGGAAGCGGACGAGGAGTACTCGGCTCGTGTGCAG
CGCATGCGGAAGATTCACATGGCACGGGAGAAGAAGAAGAACCAGCGTCGTAGTATTCTCCCCTACGGCGAAGACGACGTGAACACCGGAGAAGAGTCTC
CACCAGCTAGACCCAGTCACCCCTTCCACAGCAGTGACAGCTCGTACAACTTTGACGATTTCTTACTGCCGACGTCCAAGCGTGACGAAGATGAAGAGCC
AAACCGCCTCAGCCGTGGCCGAGGGGTGAGCTCTACTAACCAGAGCGACTCGATCCCTCCTTCAGTTCTTCGTCGACAATCCACCGCTGCTCGCCAGTCT
GAAAGCAGCTTGAAACTTCGGTCACTGTCAATTCCGAACCAACTGGAGCAGGTAGAATGGTCAATCGCCCATCAGGAGGCTTTGATCCGCTCAATTGCCG
AGCAACGAATTAAGATGATCCATTCTCCTGAAGATGATACTGTTGCTAAACTACAGCAGGTGCAATTTGGAAAAACGACATGGTAATACATATTCAAACG
ATTTACAGCATTGTGAAGTCAAGCCGAACGCGAGCACTGGTGCGCAGCTGTGCAAGAGAAACCTTCCGCCCTCTTAGTCCCTTCACAACTATGCTCTCTT
GTGGGAAATTTCTGTCATCTTCATCAGGAAAAGGGACACGCTCGGGGAGTGGCGTATCTTCTTCAATGTCATCTTCAGCAGCTTCGTTGCGGTTTACGAC
ATCAGCCAGGGCAAAAAGATCCTGCAGGTCAGTATCGTCACCGTCTTCCATAGCTGACAGAACTGATTCCCAGTGAGCTATGATGTCTGTTATGCTGTCG
GCATTTTCATCTTCGTTCGCCACGGCTACAGGAGAAGTCGCGCTGGTTTCAGCTCCATTACTTGATGTGGAACTTCGGCTTTGTGGTGTGCCAAATGCCG
TTGTCATAGGCGGTTCGGTCGACGGGATAATGCGCTTTGCTGGACTTTCGATCTCGTTGCTTGATCGTTTATCCCGCACATGCTTCCGAACTGCAGCAAT
CTTGCGTGCCTTGTCGGGGTCCATGCGGTTACGGAGTGCCGTGTGAATAAGACCAAGCTCCGAAAAGTAACGCTCACATGTGGCTGTGTTCACCGTAATC
GAGAGCACAGCTATAGCCAGCTTTGGGAGGCAATGGTCTGGGTAGGTGTTTTTCCAATGGCGTTAAAACGCTGCCAAAGGTGGCATTGAAGATGCTTTGA
AGTGACTCAGATCTTTGGGATTGCTGCCCATGTACGATCCCCCGAGCCAATCATCCAGTTCTCCTGCAAGTGTATCGCGAAGCTCGCCACCAACAAGACG
TCTGTAATAGTACTCTGCAATGTTGCAGATGCTCTGGTGTCCAGAGATCTTGGTTGCTACCAAACTTACAGCGTCATGGTAGTACGCGGGATGTAAGTAG
AGGGCAAGCATGAATAACGGCTGTTCGCATGCTGCCCACCTAGCTTCCACTAACTTGAGTAAGTCGTCGCTGTAACTACTTCCTCGAAACTGTTTGTACA
GATCGCGAAAAACAATAACGACATCGGCGAGCGTGTTTTCGTCACTTTGAAGCTTGAATGATGCGAAACAGATCGGGTAGACGACACGCTCTGCCTCCTT
TAGCGACGACCAGAATTCATCATCTTCAAGAACGGATAGTGTCGAATTGAATTCGGCATCGTCTCGATACTTTGCAGCAAACATTCGTAACGCAGTTTTG
ACCCTTAAAATCGACGCGAAACACCCCTGCATTGAATTCCAGCGCGTTGGTGAGAGGGTCAAAAATTTCCATTTTTTCCCGTACGTCTGCAGCATAACTT
CTTGAACCCGAGGTAACCATTTCGACGACGAGGCGTTTAGATAGTTTACGACCGATTCTGCTTGTTTTGCCACCTTTCGAAAACTATCGATACGCAATAC
ACTTTTCACAAGGTTATTCATGTCATGTGCGAAACATTTTAAGAATACAACCCCTGGCCACCGTAGAGCAAGAATCCTTCTTGCGCGGCCACACTGTCCA
GCATCGTCCGTCACAACACCACCAATATTCCACCCTTTCTCCTGAGCTTCGAGCAAAATTTTCTCCATTTGCGAAGCCAGCGCGAGACCATCATGTCGTC
GAGAACCAGTAGTAAACAGACCAAGAGTAGCAATCACTCCAAATAATATCAGTTGAGCTCCCAAAAGATGTAGTTTGGCGATATTTTGCCAAACATCGCT
GATAAAATTGACCCGCCCGCCAGATTTGTTCTGTAAATCCAGAACTCGTAAAGATTCTTGGCTGGACACTTCAGTAGCGTAGGCATTCAACATACGACCA
CCAAGCGCCCTACGGTTTGGCATTGTCGACAACACTGCAGTTCATACTCGCAAACAATCGGTGCGTTGTAGGGTCATCGATAAAGGAGTCAGGGGCGATG
TTGTGCTTGATATTCCACTAAACATTTCCGCATGTGCTCAACTTGCGCGTTCGAGAGAGGCGCGCAGGGTAATCCTTTGCTGCTTGCGTGTAGCGCTGCA
GCTTGATCGAGATGTGTAGCTGCCTTCTGTGACATTCGCGCTGCTGGTGTATGAGGACAGACCTCTAGATGCCTTCTTAGCGCCACCACACTACCGTGTA
TCTTCTTGGTCTCGATATCTTGCGCCGCTACTTCATCTACCCTTGCCAAACCCTCCTTTGCAGCCTCACAGTGTAGACAAACGTGGAAAACCTCTCCGAA
GTTGTTGGAAGGCTCGTTCGGCAGGGCTCGAAACTGCATTCGAACTCGGTCTGGTTTCCTCCCCATTATGACCTTGTACGCACTGGCGGTAGAGGTGAGC
TTTGAGAGCGTACCAATAGCAATGAAGTTCAGCACCAGCTCTGGGGAGAAGTAAAACCCACTCGACTATTCCTCCTTCACGTCTAAAGAGTTGGAATGCC
GACAACATACCTCGTCGTGGTCCTCTAGTCTCATGGACCTTGGCAACTTCCCGGATTCCAGGACAGAACTTCTGGCGAAAGTATCTCGGGTTACACCCGA
ATAGTGCGCTGTAGCTTCAAACTTACGTATACAGAAAAGCAGTGTTCAGGAATCGCACCTATACGAATAAAAAGATATTTTTTTTTGATATTTTTATTTC
TTGAAAAAATATTTAAATATATTTTTTGCCAACACTGGTACATGTAATTGATTCCAGCCGCTGTAGAGGAATTCAATGCGACAACAACGCTCTGACTCTG
AGTCTGTGACTCACATACCATTGTTGTCGTGTTGAATATTTGTAAAGCTAACTGTTGCGCAGAATTATTAATAGAGGTCACCGTGAGCTTGACGGTACTG
TATCAGATATTACGGTACGTGTAGCGAACATTCAGCAGCAGAAACGCACCCCGCACATTGCCGGCGATAGACAAAAATATCTTTTCACAGAGGAAACCCG
CAAAATCACGGAGAGAGCCTTTTTCTATTCTTCACGCATTCCACATGGCAACGTGCAAAAGTCAGCTACATTTGGACCCACCTATACAGTACAGTACAGT
ACTGCACCCCGTTTTCGCGGGGGTGGACCATATAGGATTTGCAAATAAACTAGATCTTAGCTTACAAATTAATGCTCATTTGGGTTCAGAATCATCATAT
CCAGAAGTTTATTAAAGGTCCAAGGGCGCGAAAACGGGGTGCAGTACTGTACCTGTATTGGCAAAACCCATATGGTTCTCAAGCATACTGGCACCAAATA
TCAAAAAATATGTTGGTAGTACTATTACTATTTTGGTTTTTAATTATCTTACCCTCTGTGAGCCAAGGACTCACAAAAAAAAGAACTCTTTCGGTCAGGT
TCTAGAACAGCAGTAGGCTTAAAGACTGACGAGCATTTGCTCTAGTACTTCACTGTGACACAGTCAAAGGCGATCGAGATGGAAAACTGCAAACCGTTAC
AGTTGTTTAATGTCGATAGCGTAAGCAAGGTATTTGTTCTTGTTTTCTGCCGAAAGTTTGCCTCTCTGAAAAACGGACGGGTACGCGTAACCGACTTCCA
GGTTTGGTTGGTTATGGTTGTCCGAGCTCACCAGAGGATTATATGTTTTTGCATGTTTTTCGTTATTAAGAATTTTGGCGACGGCTCGCGCCTTCAACCA
GCTTATTTTGAGCGGAAATATTAAATAAGAAAATGATTTTTCACCTTTTTAATTCTTTACATAAATTGCACGTAATTTCCGGTTAACCGATCGCTAATTT
CGTCCAGCCGAACGGTCCGTACGGCTGGCTATGGTCATCCGAAACTCCATGACCATGGCTTTCGGACGGATACAACTAACCGGAAAATTACGTTTGCGAC
CTCGGCTATCAGGTGATTTTATTACTATATTAACTTCACCGATTTTGGACTTACCATTAACCCCTGCAAGCTATTAATAGCCAAGCCGCCCAAATCCGCC
TGCAGATATGCATTTGCCTTTATTTAAGCCATATTGCTACTTGGATTGCACGAGTTTAGGTAAATCTGATGGCAGATATGCGCTTGCTTCATTCAGAACA
CACCATTTACTATTAACTCTACTGGCAGAATTGCGTCACTGAAAGAAATATGCTGGAAGCTATGTACTTGCATTCATTTAAGCCATGCTATTAAATCTGT
CGGCAGAATTACAATACATGTGGCCGTAGCAAATCTGCCGGCGGATATGCAGTTGCTTTCATTTAAGCCATATTATGACATTTTTTTGGTCACTACCTTG
TTGTTGCTGGGCGCTGACGACCGACGTAGCTGCAGTGAAATCAAAGCAGGCAGACCAGCGTTGTGCCAATTTACATTGAATAATTGATTGAGATTTGCTT
GGACGCCACAATTATAATTGCCCAATGTCGATATTGTATTGCTCACTACAGCCTCACTACTCATGCCATCGACTACAACGCCATGTCTACCACAAGCTCC
GGTTAGCCTTTAAAAACACAAGCATTTCCAGTGTCGCCGGCCTCATCGCTCGCCGCTGATCAGTGAGAAAGAGCTTTGACTTGGAGAAAAGTCTCTCACA
TATGTTGGATGTAGGTGGAGTGAAGTTGGTGTCGATGTACGTCTCCTTGGGTCCTGTCAGGCGGCGGCGCTTCAAGGCCTGCTCCGCAAAAGAGATGTTG
TCTTCGTCATCACTGCTCTTCTTGTTGTCATTTGCTGCTAGGTCATTCGGTATGGGAGAAAGAAGTCGAACGGAGGCTGCCTTCTCAGCAGCAGTCAGTT
TCCGGCCCGACTGAAGCTTGACGAGAACCCGTTCAAATACGGCGTTATTGACAATCGAAGCGTTCGCACTCAAGTACTTTTTCATCGACGGGAAGATCTC
AATTGTATACTCGAAAAGCTCGCGCGCATCGAGCATAGTAAGTGTCTCGCTCTGCAGCTCTACCGTCACACTGTCCAGCTTTCGAAGATCCTTAAGCAGT
TCTGACACCTCCATGGCTTCAGCTGCTGATAGCATCAGCTTGTCGACACCGCATTTTGCAGACTCAGCTGCCGGAGAGCTGGGATCAGCTTATCACATCG
CTTCAGCATCTTCATTGCGCTGCTCCAACGCGTCTCGTTCTTAATCTTTGGGTGTACACCAGTCACTGACGCCAAGCACGCACGTCCTTTTACTGTTGAC
AACTTCAACATGAGTTTGTTGGCCTTGTTGATCAAGTATTTGTGATCCTCTAGAAATATTTGAGCAGCTAGGTTGCATCTATGACTAGCACAGCCGACAA
AAGGAATGCCACCGTTATCTCCGAGGTACTGGTTCACCGAGCAATTATCCCCGACAACGAACAACACGCTAGCCCAGGGACGCGAAAATTCACAGAGCGT
GTCAGCCAAGACGTCACTCATACTTTGTGCACTTAGATCACTCTCATCAATCAGGGGGGACAGAGCGAGCAGCACTCGGCCTTCAGATTAAGAGTCCGTT
GCAGTAAAGACAGCG