Description :
From Genome Similarity Track
Location :
Scaffold_43:14071- 16541
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_43-fgenesh-gene-0.4Placental protein 11

Sequence
2470 bases(100 bases per row)
CGCATGGCAACGACTGCCAGcAGCGATATGGAACCTCGACGCAaCAGTAATCAGCGGGTTTGGCATGTATTGTTCAGGCGACAAGCTGATGTTATTCCGC
CGCACTGACGTTGTCAAGCTaTTCGACTTCATGAtATTTTACGTGTCGGTCGATGCGGATACGGATCGCGATCCCCCAGTGTGTGTGCGCTTGGAAAGAA
GTATGAAGAAAGCAACCACTTTGGATGAACGTTATCTTGATTGATTGATGGTGTATTAGTTAtAAGAAAaCCTAGATAACCCTTCGGCAGCCATGgCtAT
CGGCcGCCGGACATCATGAACGTTATCTTGCCGATGAGATTTTtCAGGTGAAGTTGAAGACTCACAGAAGCACATCGAGTTtCtCGATGGGGTgACACTG
CATATCAATGGTGCGGAAGAAATGCTATGTAGAGGGTGGCTCATGAACAATCGAGTCAATCGCCGACTCATCGTGGTCATCTCGCGGGAAGACAAACATG
GATGAAGATGCTGCAGTGAATGTCCGGgAACATTTTGTATCATCCTGGACTActGAACGAATACTtcACTGCAGTTGATAATGATGGACCACTgaTCttG
AGACTTGCGTCTGTCCTACAAGAAGACCcGAATGCTGCGATAaAtGGATGGATTCTGGAGATGCACtCTTtGCTTGTGTTCGCAAAGGTGGTGTGACTCT
ATACGATGGCGATAAGGTGATTCGTTGGTCACAGGGCGAGctCCTAGTCGTCGATCCATGgAaTCTGCCAGAGCTCCCAaTGCTTTGGCTGGCTGAAACC
ACACAAGTACAATCAAGATGGCTACGATGCTATCTACATCAGTAGGGCGAAAAAaCTTATCCGCCAaGCGTTCCATATCCGATACTTTCACCAATTTTTG
TgcTCTCTCCGCGACTCAGCCTCGTCGTTTGAGGTGAGCACTCGAGAGCTTTTtATTCGTGATCGAAAGAGAGGCATTATTGTCCAATTTCAAGTTTTCt
ACAGTCACGGGCCGAGGCCTCTTGGCAGCTTTTCCCGGCTGGGAGAACAACGGCGTGTTGGTACCGTATTCAAGGAGACAAACAAGAGCTGGAACtGATG
ATCAGAACGCCATGGTGGGTTACAGTGTAACCCCCACAGTGCTTTGGGTACAGTGTGTTGTGTTGcGTTGGGACACGTCGTTTTGCTGGCGAGACACCTG
TTCCGTCAGACCGTAAACCGCATCGACGCTTTCGATTGGCTGAAAtCcTGTTTGTCCCTGATTTATTTCGAACAACGTGGCGTTCGCCCCATgCTCAcGA
CGCGGCAGTCGGCATCTAGAGCCCCAAGGGAGAGACGATGGCCAACACGACGCCCACGGGTACGAGCGGACGGGAGGGAGAGAGGTAGAGAGACCGAGCT
AATGCGTGTGCGCATGCAGCCGCGGAGCTGGACAACCTGTCGCTGGCGTGCGACCGCCTCTGGCATCTCGACAAGAACCGCCTTCGACCGGGTgTCGACT
ATGAGCTCAACCTGCAGCATGGCAAGCACTGCTGGCAGCACGGCGATGTGGCGgCCGATCCGCTGTTCACGTTCGTGGATGAAgACGtGTTCAAGCGCCC
GAcGTTCCACCTCTTCACGCAGCTGTTGGACAACTACGAGCGTGGAGTGAGACGAAGATGCGAGCGAATCTCCACAGCTCGGATAGCATTCTGATGGTCG
ATTGCATGCAGGTGGGCATCCGCGAGACTGTGACAGCCGAGGAGCTGAGTGAGAACCACGCGTTCCTCACGGCGGTCGTGGACTCGGCGCCCATGCGCTA
CGCGTACAAGTACGTGCGCCGATCGCATCAGGCTGGTGGTCAAGGTGAATGACTGAATGCATCTTGTGATGTAGCTGGCTGACGAAGAaCAAAAAGTTCG
TGGGCGACAAGTCGGCGTTCAAGAAGAAGTTGGATACGATCTGGTGAGCATGGGCGCACcGGAGGCCGCTGGCGTGGGCGTTCGACTGACTGTTCCATGC
AGGTTTGGCCTCTACCGCCGACAGACTCAGAACGATTCCTCGGGCTTTGAGCATGTCTTCCTCGGTGAAGagaaGGATGTATGACTGACTGTGGTTTGAT
ACTGTGTCGATACACGTTGCTGATGAGCTCATGGTGACATTAGGGCAAGATCTGTGGCTGTCACAACTGGATCCAGATCTACTGCGAAGAGCGTGCAGGG
CGGTTGAACTACTTGGGATATGTGCGTCCCAAGCAGGTGAGTGCTtGTGGCGATCATATCTGCACGTGCAACGCCTCATTGACTGTGGACTCGACCAGCG
TGGACACGGCATCACAAtCCCTCAGAACCACGAGCAGCTTGTGAGCATTCAGTTCATGTGGGAGAAGGAGATCAAGCCTGTCTCGACGAGGTATGCTTCG
AGATGGAGAACCCATGGTGAAGATACGAGACTGATCGTAATGGCTGTTTtGTGGCTAGTCTTATCGGTGT