Description :
From Genome Similarity Track
Location :
contig_38:140702- 143504
Transcript NameFunction/comments
g8328.t1hypothetical protein

Sequence
2802 bases(100 bases per row)
ATCTGCAGAAGGAAGAGTTCTCGATCCTGCTCCAAGTTGACCCTTGTTGTTACGCCCGAACACCATAACCCGTCCGTTTGACATTAGAATAAGCGTATGG
TAGCACCCACATGACGCGACCTTGATTTTGGAGGACAAAGGTAGTGGTACATACTGTGCACTATTCTTGTGGTCCTTGCTTCCAATTCCCAACTGTCCAT
AGTCATTCCGCCCCCAAGTTATGAGCTTGCCTTTTTCGCTGATCGTCACAGTGTGATAGTATCCACAGCTCACCGCAACGATCTTTTCATCGCTTTCTCC
AAGTGATGTTTTAGCCAGAGTCGGTACCTTCATGTTTCGTGCATGACCCAGGCCAAGCTGTCCGTAGTCATTCTTTCCGAATGAGTATACCTCACCACCA
CTAGTAATTGCGACGGTATGATATAGTCCACACGCCACCTTGATGACCATTTGACTCGATAAGCCATCCACTAATTGCGGAGTGTGCTGGTGCTGGGTAT
GGTCAAGGCCCAATTGTCCACAGTCATTCATACCAAACATCAGCAATTCACCGTTGCTCGATACAATTGCACTATGATGATAACTGACGGCGGCAGTCGT
AATATGATACTTTTCACGGACACTGTCGATCATGCGGGGCGTATGGCTCTTTGAAATTGTAGAGCCAAGGCCTAATTGGCCCCTGTCGTTGTATCCCCAT
GAATACACAGCACCGTCTGCAGCCACAGCTAGCATGTGCTCACATCCATTCGCTGCAGCGACCATATTAATAGCAATCCGCTTAGTGCACGAACAGGAGT
AGCGATGATAACCCTCTCCTCAAATGTTCCATTGCCGCATTGGCCACTCTTGTTAAGTCCACACGTGTAAACTGCACCATCCTTCATGACTACAGCGAGG
ACTTCATTTCCTCCAGCAACATCACGAACAGCCTTTGCAGAAAAGAATGGTACATGCTCCAGCTTGCTCGTTGAGTTACAGTGTCCTAAGCAAAGTTCTC
CGTAGTTGTTTTGCCCACATGCAAACAATTCACAGTCATCAAAGCTGGCCACACCCGACAGTCTTTCCGACGTACCAGTTTGTCCTGATGCGGTTACTCC
TATATTTTCATCTCCGAGCGCAGCGTTTGGCGATTTGGATCGATTTAATACGTCACCGAGTGTTGCGATTTGTCATTCCACGACCTTCGTGGTGGGCAAA
GAAGAGTGTTTTCCATCTGATCATCTTGAGATTCACCGGAAGTGTAGACGTAATAGGCTGAATCAAGATCCCCTCGGTTGTCGTCATAACATGCAGCGCA
CAGCTTGACACTGTCATCATCTCTCTGTCCATAGTATACCCCACACAGCGGCATTCTCTTACACTCCTCGCAACAATAGGACCCTGTCGTGCTTTCGTTG
TATGCAGGGCCATTGTCGCGGTCAAAAATGCCGCATAATCCAATGAACCCGATGTCGATGTTTGAACCAGACGCCGGGCAAACTGCCTTTACGAGAACAT
ATCGACCAGTGACAGGGTAGGCCAACTGTCTTGAAATCTGAGCACAATTACCATCTAGTACGAAGAACGCAACAGGCATACGTTCATCTCGGGGGCAATG
TCCACTGCTTGGGGGGAAAGGCAAGGCTGCAAAGTCTTCAGCGGTCATGTCGTCAAACTCCTGATAGCAAGTTAGATCAGGAGGACTACTAGTCACAAAT
ACTACAGCACAACGCAGAGGGCTAGAGTAACCAGGTCCAGGCCCTCGAACGCTGATGTAGCTCACACACATAGGAGTGTCAACTTCATGCTTCAGCACCA
GATTGACATTGGTTCCCTTCGCTGAGCTGTACACCGTCGTATCGTCCAAAAGACAATTTCGAGAAGAATGAGAGCTACTAAACTCGCCACCGTCGCAGGA
ATGCACTTGTAGTTGCAAGCTCTTTCCTAGTTGCAGCTCATTTGATGAAGAGATTTGCTGATTCTGGAATTTCGTGGCGGGGGAGAATGCGTGTGAAGGT
AACTCAAGGCGGGGGCGGGGGTGAAAATTAACGTCAAAGACAGTGCCATTGCAGAGTGCTGATACCGCAGGGAACATGGGCTTGCTATGAGTAGCAAGGT
TGAAGTGGCACACATCAGGTTCCGAGTGATCAGAGAAGAGTGTGACGGTGGCTTTTTCGAAATCAAACAGAATGCCAAATATTCCGCCTTCTAACACGTC
TTCTGGGCTATTCCATTTCACGTCAAGCTTGCTGTGCCTCAGTGGCATATCCAACTCAGAAAAATCATTGCCAACAACCCCACAACTGAGGGCTGACCGT
CCATCTCTTCCAGCCGAAACAACGCGAATTTCAATGAAAAGACTCCCGTTTTCGAAACCCTGGTTGGCCACAATTGTCTCGAATTGGTCCTCGGATGAGC
TACAGTCACCGGCAACCACTGTGGATCCATTTTGCATGAGTTGAAGCCGGTCACCTTTGAGCTTTCCGTTCCAACTGATTGTTGCCCCATCAAAAGGAAT
TGCGACGAGACCTCCGGAAACAACTGGGTTAGAAAACTGAAAATTGGTGCTGGCGCACCACAGTTTTGACGGAACTGGGGGTGCAAGGTTCCAGTGTACG
TCTGCATTCTTGACACCGATCGAAGAGAAATAACCGCAACCAGTTATACCTGTCATGGTTAGAGAAGCAGTGTAGCACCTCCTCGAACCGATGTAGAACT
CTATCTGCCTTTCCTCGCAATTCAATAGCACGCCAAGCACATCGGTGCGATTCCATCGAATTCCGGCAATACCGAGCATTTCCCCACTAATTCCCTCGCG
AT