Description :
From Genome Similarity Track
Location :
Scaffold_126:140685- 148719
Sequence
8034 bases(100 bases per row)
AGGATGGGTCAGATACGTCGTCCGAGCCACGACGCATGTCTTTGGGTTTTTACGGGGCATCCATGCTGAAAGCGCGGCGAGGAACCGGGAACAGGAAGCG
CCCTCGAGTGTGAAGACTCGGGATCCAGGACGCCCTACCCGTGATCTGATTCAATCCAACCAGGATCGAGCCAGATCCAGCAAGAAGCCAGTGGGATTAT
CGTCACATCGGGTGCAAGGTAATCGCCTCACGGATCCTGTCTCGCCAGTGGACCAAACGGCTACAGGCTCTTCCGACACCTCCTCGGGCACCCTGCAACG
GCACTTCAAAGCTACGATGAGTCGTTTCCTGGCCGAACAAGGCATGAGAGCGCCCAAGCCGCATGCGCAAGTGTTCCATGAACATGGGGCACGAGACGTG
GAGATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCCCCTCGCCAGCGGCGGTAGCAACAGCTGCAG
CCGGGACGGATGGATCGTCTATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAAGAGCTCACGGGCAAGAATCAAGACGAAGACCGAGCGCA
AACATGGATCCGCAAAGTGAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAAACATGTCTGTTCTTTGCGGATCTGCTAGCGGGGTCAGCCAGA
AACTGGTATCGGCAGCTGAACAGATCCACCAGGAACAAGTGGCCGGATTTGCTGCGCAGTTTCCAAACCCAGTACTGTGGATTGGGGGTGTCGGTGGCAC
GACAATACTACCACGCTCGCCGCAGATCGGATAAATCCCCGCTTGAATATCTGCATCGGCTAGATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGA
TGAGGGATCCAAGGTACTACGGGAACACGTGGATAATTTCATCGAGACATTCGGAGATGTGGATCTGGCCGGCAGGCTGACCCTGTTACGTCTTCCAGAC
GCAGATGAGCTTGAAGAAGTGCTGCGGGCTGTGGATCGCGCGAAACACCGCCAGAAGAAGAAGGCGGTCGGATCTGGCAAGTATCGCCAAAAAGCTCCGA
CACCCACGGCCCCAGCGCGACGTGTCCACCAAGTCACGGCGCCTGACTCAGGAACTGAATCGGGATCCGATGGTTTGGACTCCGATCCAGAGGATTACCG
TCGAGTCTGTCTCAACGATCGTACGGCGAAGACTGAAGACAACTCTCGCACTGGTGATACCGTATCCGGGGACCGTGGTATGTACACATCCCGAGAGCTG
ATGGACGGGACAGGGCAAATCGGGTGCTCGCAGTGTGGATCCCAGAAGCACACAGAAGCTGGGTGCTGGAAACATCTGGTTTGTGAGAAGTGTGGCAAGA
AGGGTCATCCCGTTTTCATTGTTTTTACGTGTGTCGCGGTTGTGGCGAGATCCACGACGCCGGCAAGTGCCCGATGGAGGAGTTCTACGACCAGATCCGC
CAATGGCTTGATTCAGACAAGCGCAGAGGGATGTAGCGAGAAGTGGCAAAAAAAATGTTTAACTAGGACGCTCTCCGGGTTTGAATCCGGTACAAACCGA
GCGTTCAAGGTAGTGCATTTATGCATTTGTGAACAAGACATCGCTAAATCCATGTAGCAGGCCCCTAGATCCAGTCGATAATACACGTGATCTTCATGAA
GTGTCAGCTGCCAAGGTCTCTAGCTTGCGCCAAGTGGACGAATTTGCCAGTTCCGAAGTCCCTTCAACATTGGATCTACAGAGGGGAGAAACGCGCGGTT
ATTGGGAGAAACGCCAACATGGTCGATGGCTTGAGCCTACCATGGGTGAGGTCACTGCAGATCCACCAAGGTTTGTCAGGTTACTGGATCCCGTAGATCT
GATGTTGTTGTATCCATGGATCTGCTGCCAGTGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGTTATAGAATCAGACGAGACAAGGTAGGGGGCA
AGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGG
GAGTTGGAGCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTCTGGTATATTGG
TTCGATATTTGGGTTGGAGACCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCCGGAGTAAGGTTGGATCTGGCGGATGGGACAC
TGTGTTTCCCGGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCTTTGTACGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTGGATCGA
GCCCGGAGAGACCTCTAACTGCCAGATCGGTTGAAGTGGGTGGAACATGAGAAACTGTGGGTCACCCGGGGTGAAACGTGGGTGCCTACAGAAATCCAAG
GACCAGGTCGCTCGCAATATCTCCAAGGCACGAATGTCAGCGACAAGAGAAAAATTACTGAACCACTATGATGAGATTGGGCGATGGTTGGCGAAGGATG
GTATCCCTAGGCGACCTGGATATGTTTCAGTGGGATCCCGTCGCTATAGAGAATGACAGAATCTGGCGTATGAACCGACTACCGAGCCGAATCTCTCGGA
GAGGCGGAACTCCCAGCGGAGCCAACTGGCCCTTTAATGGATCGGCCTTCAACCCAACTCCGCGAAAGATCCCACAGAGGGATCGTCGGATTGGGATCCA
AGTGGTAGAGGTTGGATCCAAGGCCGCTGGTGATACCCAGAGCCGATCCCTAGATAACGAAGATTCGGTGGATGGGGGATCGCAGGAAATTGAAGTCGGG
TCGCTGGATCCTGCTGACCCGCAGTTGGATCCGAGCTTTCCATTGGACAGAGTGCCTGGATCCTTGTCGAGAGTGTCAACACTGGCTAAACAGGATCCGT
CGTGTGAAAACTCACCAGAAGATCAAGTCGATCCAAAAGGTATTTTCCCCGGTACCAGGATACCCGATCCAATGAAGACAGAAGGAATGACGAGAGAGGG
GGAGTCGCGGTGCTTGGATCCAGTGGTGGATCCGACAAAGACTGAAGATGAACAAGTCTGCTACCATGAAGGCGGGGATCTACACGCCGAGGATCTTGGA
GAAGGTATGGCGGTGATCCCGGAGATACCACTGACCACAGAGGAGGTCACGAGTGATGATATCCAAGTGGATCCGGGGGCGAACGAACCCGCGGAAGTGG
ATCGGCTACGTCAGAAGATCTGGAAAAGCCGACATCTGCTAATTGGCAAGGGAAACGTATCATCACCCGCTACACGCGGAGTCAAATGTGACATGGATGT
TAGTGATGCGAAGCCGATCGCTCAAAGGGTGCGGAAGGTGGCGCCTCAGTTCCAACAAAAACTATCGGATCTGATCAAAGGTCTGCTGCAAGCCAAAATC
ATAAGTTTCTCAACCTCCCTGTGGGCATCTCCAGTGGTAATCATCGTTAAGAAGAGCGGAGTGGATATACGTCTGTGTATTGATTGCCGGATGGTTAACG
GCCTGACCAGACTGATGGTGTATCCGATGCCTCTAATCAATGAGCTATTGGAAGATTTGGATAAGGTACTCTGGTACTGTTCTCTAGATATGACAAGTGG
GTTTTGGGTGGTGACTATGACGGATCGAGCACGCGCAATATCCGTATTCACCACACCATTTAGACTGTTTGAATGGAGCCGGATGCCGTTTGGATTGAAG
AATGCACCCCAGATCTATCAACGCCTGATCAATAATGCCCTCTACGGATTTACCCGAATACCGGAGCTCGAAGGGGATAGATCCGGGAAGGTCATGCGGA
AGTTGATCCATTCGAAGCAGGAGAGCCAGGTGATCTGGGAACCCCATCCGAGTTAGGGCGCAGATCCTATGTCGACGACATTCTAATCCCGGCGGAATCG
TGGGATCAGCTGTGCGGGAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGGATCTCTCTATCAGCGTGGTGAAGAGTTATTGGGGGATGCGCAAGG
TGGATTGCTTAGGTCATCGAGTCTCTAAGGAGGGATTGGAGGCGAATCCTAAGGACTTTTCTTCGTTGGCAGACTTGTCCTTCCCACAGTCGCTACGGGC
GATGCAATCCTTCTTGGGTAGGTTGAACTACTACAGTCGTTCATCGAGGGTTACGCACGTTTTTGCTGCAGTACTCTATAAATTGAGGAGGTGGATTTTG
CTGCGATGGCCACTTCGGCTGTTCGGATCAAGATCCAACAAGCTCTGGCCCTAGAAATACCAGATCCACGAGGGGATTCACATAGTACGACGCCGGAAGA
CGACCTGAAACAGGAACTGGATTCATCCCGGGACCAACGGGGAGAGGATCCAATCTGGACAGAGTTGACGGAGGAGAGCTCGGAAAAGGTGGAGCCTCGG
TGGATCCGAGCTCAGCACGTGTTTGTGGAGCTAAGGAACATGATCGCTACGACGCCCGTCCTCCGCCATATTGATCCGGAGCGCCAACCTACGGTGATCG
TCTATGCTGGCGATTGGGCGGTCTCGGCAGCTTTAGTACAAGAACATGAGGGGATCTGTCATCCGGTCACCTTCGTCAGCCGAACGCTAAAGCCTAACGA
CTTGAATTACGGTGCGGTGATGAAAGAGATACTCGCACTCCTGCGGGTGTTGGATCTCAATTGTAGCCTGCTGGTGGAAAGGTCCATCCGGATTTTGACT
TGACACTCCACGCTCGCCTGGTTGTTTAAGTCGGCCGGTCTACAAGGACGGTTGGGACAATGGGCAGCTTTACTTTCACCATGGACACTGGAGATCGTAA
AATTTTCAAAAGGAGAATACGAGATCCTGGGCGTTTTGGCCGCGAGCATCATGCCCAGAGCCAAGATGGACGAAGCACTGACTAGGATCACTCCTAAAAA
AGAGCCGATACGCCGGATCCGGATTCCGATCCCGACGGTACAAGTGGATGTAGATCGGTACGTCCTAAGTTTCGATGGATCTGCTCGCGTGCGACGCGGA
GGAGGAGCTTACAGCGCAATTCTGTGGAAACTGCCCGGATGGGAAGTGATTAGGGCCAGATCCACTTACGCGGAAGGTCTCACCGTCAATGAAGCGGAAT
ACAACAGACTCCTGCTGGGGTTGGATCTACTAAAGCAAGAGGATCCGAAAAGGCTGGTGATATGTGGAGATTCGAATTTGGTGATCAGACAGGTGCGAGG
TGACATTGACCGCAAGGCCCCGGCCCTAACGCTGTTACTGCAGAAGGTGATGGCCCACTTACGTGGTTGGATGAATCACGAGCGGGCACATGTCAAGCGA
GATCGGAATGCCAGTGTGGACAGCTTGGCAAGTGCCGCTTCACGAATTCAATGTGGTGTTGAGGTGGAGAGAGAGGTCGAGCGTCAGGATCTCGTCACAT
TAAACCGACTAGACGAAGTGGTGGTGGTTGGATCCGTGAAGCGGGCGGTCCAGATTATGGCTGTCACTAGATCCAGAGGAAGGATTCGATCCAGCCCCCA
GATTCTCGATGAAGCATTTGTGAAGGGGGTCCGTATTGAGCGGATTCTTAAAGCACAGAACGAAGAAATGTGGATCCTGGGGCTAAAGAAGTATCTGGGG
ATGTACGAGACCTGAGTCGGGAAGACGCCTAATCCTACAGTATTATCGCTACGGATTATGCAGTGGATCTGAACGATTTGCTCTTCTATTGCCCTCCCGC
GAACCGAGTCAGCGGGGATCGAGACGGATTGATGAGATTGGTGATGCCGGAAACCTGGCAACAGGATGTCCTACATCACTATCACGCTAGCTTAGAAGGA
GGACATCAGGGAATCGGTCGGACCTACCAACGGATCCGAGACTGTTTCCACTGGAGGGGACTAGTCAAGAGTGTGCATCGATATGTCGGTGAATGCGTGG
ATTGTGCGACAGGCAAGGGCAGGCCCACAATGAAAGGGTGGATCTAGCCCAGATCCAGGTGTACGTCGGAAGGCTCTGACATAGCTCCTCAATCAACAAG
AAAATGTTAAGAGAAGACATATTTTCAAAGTAACGAAGAGTGGGTTAGAAGAGCTTATGCAAAAGGCTGACTCGGCCCAGCTTCCAGCAGCTAATTACAA
CTACGAAGCGGATCCACGAAGACTGGAACTGGGGGCGCAGCGTGAAAGAGCGGTATGGATCAGGCGGTCTGGGGCTGAACATTGCAGGACTTGCCCGCCA
GACGCTGGATCCGGTGTCCTAGATGCTGGCTGGGGTCCCTCCGAAATTGGATGCGCCCAGGCTCGGCTTCGTCGATCTCTTGCAGAGCCTCCACTAAGTT
CGTAGGTTCCGGGCGGTGGAGGCTGGGATTTTCCAAGTTGGCCTGACGATATACGGATCCCGGAACACACGTCACCTTATCCCCACGCCGGGGAAGGTGC
AAGAAGAACGGATCCAGCCAGATATTCACGTCACACCAACCGTCTTGGATTGCCAACACAAGGATCACGAGAACTTTCTTCCAAGCCCGACCGGTGTGAC
TGCGCCTGTTGCCGCGCTGCTTGTTGAAGTTCAACAGCCATGTCGAACCCCGCAGTTGGGCGCGAGAAATAGGGAACCGATGGGAGCCTTCCCATATGGC
AATTCGGTACTTGGAAACGAAATTTCGGAAGGCGCCAACGAACAACCCAAGACGTCCATCGACGTCACCTCGGAAGCTAATAGAATCCACCAGCGTGGTC
GTCAACATATCCCGTGGTGCGGCATTATGTAACTCTTCCACGTGAGATCTGGTGACGAGCGAATCCACATATCCGGACGTCGGCAGGACATCCTCTTCAC
GAGGGAATATCCATTCAGTGCGAACGGCAGCTCAGGGAACAGGACAGTGATCTTCATGGTGGCGATGGTGACCCGGTTCAATTTGTTGGCGGACCAAGGC
TCGATATCTCTTGTGGCGAAAGCCACAGGCACAAGCCGACCAGGGATGAAGGTTGCATCCGGACCAAACGGAGCCACGGAAAGCATGCCGGGTAAAGAAG
AGTTAGAAGGTGTGGGGATCAAGGCAGATCCAGTGGATCGGCCACCGTGAGGTGATCTCACTCCATCATCGGTGCCCGATCGATCATCACTGTCGACCTG
GATCGCAGATCCCGCAGTGCCGGCCCCAGGTCCAGGCGCGCCAGCGACTTGCTTGGGCGGCGTCGAGAGGGATCTCCGCCGAGCTTCGGGTCTGGATTGG
GACAGAGCCGCCGCGTGTCTTCCTCCAAGGCATCGTCGGCGATTCGGGCCTCCTCAGAATCCTCAGGATCTTCGTCGTCGTCGTCATCATCGTCATCATC
GTCAGGGCTGAAGGAATAGTGGCCTGTGGGGAGAGTACGCTTCGAGGATAATCGAATAGGAGGTCCCGAGCCGTCGGGCCAATCAGATCCCTCGTCATCG
TCGTCTTCCGAGCTGCCGAGTCCACAGCCGGTGAAGATAGCACGTTTAGCTTTCCCCTTACCAGACCCAGTTCCGACAATTGGAGAACCGGTAGAAGCGG
TTCGAGGGACGGTAGGCACCGTCATGGAGGGGCCGGCCGTGGATCCCGACTGAAACGAACTAGACTAGGCCGTGGATGTGGCTAGCCCCGTCGTGGAAGG
AGCAATTGCCGTGGATCCGGTCGAGCCGGCAACTGCCTGGGACGACGTCGCGATAGTGGATCCAGCCTTGGAGCTAAAACCAGTGTTTGACACAGCGACG
AATCCAGTCTTGGTCACAGAACCAGTCGTCGACGCCACCGCTACAGATCCTGCCTTGGACGCAGGTCCGGACTTGGATGTGGATGTGGATCCGGTTTTGG
AGACTGGTTTAGAGGCAGAGTCAACTTTGGGCTTGGCCTTGGCAGGGGCTCTAGCTGGGGAAGAAGCTCGGGTCTTCTCGTGAGGCCGGTGAGATCCAGT
ACCAGGAGCAGGGGATACACTGCGCGGCCGTTTC