Description :
From Genome Similarity Track
Location :
Scaffold_435:14066- 18605
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_435-snap-gene-0.14Isoform 4 of UPF0533 protein
Pytiw_DAOMBR242034maker-piw_contig_435-fgenesh-gene-0.3Peptidyl-tRNA hydrolase
Pytiw_DAOMBR242034maker-piw_contig_435-fgenesh-gene-0.7Calcineurin-like phosphoesterase

Sequence
4539 bases(100 bases per row)
TACGTGATCCGGAAGACGCGCTGAAGCTCCTCCTGCGGATTCAGTAATGACTGCGGGCCTTTTTTCAGCAGCTCGCTCACGCCGTCATTATCCAGTAGAG
TTGACGGTGTTTTGGCTTTCCCCCATGAGTCAAACTCCTCCGCGGCAAAGGGGAGCAGCGGCAGGAACTTGATGCTGTCAACAAAGAGCGGGAGCTTTGA
GACATTGCGGATCTGCGCTTCGACGAGTGATTCGTCCTGCAGCTTAGACTGCTTGAAGTTGATCACCAGCGGGTTCTGCACGGCGAAGCGGTAGAACTTG
CGAAGCGATTTCTGCTCATTCGAGATCGGATCCACGTACGACACCCCCACACGAAGGCTACATGAAATTATAACATGGTTTGGAGCAGTGTGAGTGTTAG
CGGCGCTATTTTGCCAGACTGTACCGCCCAGCTCAGCGAGAGCCCTTTTTCGGGTACGCACACATGGTTGCCGATCTGGTTGAGCGGGTAGTCGACGACC
ATGTCGATCGACGAGCCGGCGGGGAGCACTTTCGCCGGGTTGGCCGGCGGCAGCTTGCCTGTGCGCGCGTAGCGGTTGTCGTGGAGCTCGACGCGGTCGT
TCGCGCACTGGATGTTGACTGTGAGCCCCACGTCGCGTAGGTCGCACGCATATTGGTTGATCACACTGATGTAGCTACTGAACGTGTTGCCCAGGAAGAT
CTCACTGCATGTGGTGCGCAGTAGCATAATAAGTAGACGTGTACGAGTGAGTACCTCATGGTTGTCTTCAGATAACAAGCTAATATACAAAAGGACGCAC
CCAAAGCTGTCGGGCAGGATGAGCATGCTCGACATGGCGAACTCGTGCTGGAGTGCGGTCGCCTCCGAGAGCGTCGTGGGCATGAGCGACCCCGACGACG
CCCCTTGCGTGAAAAGCTTGGGCTTGTACAGGCGCATCACTGGCAGTAATCAGCACGAAAAGGAAGTAACCGCATGAACGAAATGGTTTCCGCATTCTGC
AAGTTCAACGCTTGCGCGTCTCCTATAGCGCTCTCCGTGGCCAGCACGCGTACCTTTGAGCGTGGGCTGGACGGCCGACATTGCCGACGCTACTGACGAC
GAGCCCGAGGAGGAGCCGGGCCCGCTGCTGCCGGCTTGCGCGCCCGTCGCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGTTCGCCGCGCTCATGGCTTCTTCGTCTATTCCCAATTATCGTTGATTTTTGATTGAGTTCTT
GTAAAATATCCCTCTACAAGAACTGAATGGAAAGGCAAAAGTGCAATCTCCCTTTACAAGAACGAATATATTGATATCCTGGAAGTCAATGCAATGCTGA
TTTTGACTTCTTGGAAGTCAATTACCTAACCACGGCCGCAATCTTGCGTCACGCATCACAACGAGAAAGAATGGAAGAGGTCGCGTGGAAGTGCTCGGTG
GCGTTCCTGCTCGGCGCCGCGACACACTACGTCATCTCGTACCACCTGCAGAGCGGAGAGAGCGCATTGGCACCATCACCAGCAACAGCAGCTGCGACCA
GCGAAAAAAACACGAAGGCGAACGACGGAGAAGCACCCGCGCAAGATGGCGAGGGCGACGAGGAGTTCGAGTCCGATGACAGCGAGTGGGAGGACATGGA
CGAGCAGGAGTGGCAGCCGCACAAGATGGTACTTTGCGTACGCACGGACCTCAAGATGGGCAAAGGTACCGTGCAATTCTGCTGCTGTTGGTCATGTATA
TATGCTGCGAGAGTAAACCTGGTCACATTTTGTAGGCAAAATCGCCGCGCAGTGCTGCCACGCGACACTCGGCGCCTACAAGCGCGCACTGAAGCGTGCC
CCAAAGGCGGTGAGGGCCTGGGAGATGCTTGGCCAGGCGAAGGTGTGCCTGAAGGTGGACTCGGAAGAAGAGCTCTTGAGTCTCGCCGCGAAGGCGTCCG
CGCACGGACTTATCAACTACGTCGTGGTGCGTTCTTATTTCGCATGGGAATATATTGCACTGTGTGCCACGATACAATGTGCTAATGCGGTGCGTGGCTG
TGTGTGTGTGTGTGACTGTAGATCGATGCTGGGCGAACGCAGATCGCGCCGGACTCGAAGACTGTCGTGAGCATTGGCCCCGCGCCGATTGAACTCATTA
ACGACGTCACTGGCCACCTCAAGCTCATGTAGTATCACGCGGTGCAGTGCAGTAGGACAATCGATGAACGACCAAGCGGCAACAAACACAACACGCAGAC
AATTCAAAAATCATATCCCTCTGGGACTTAGAAGCCTCGCATGGTCGCCCGTGTTCATATCATCGTCGTCACGCGCCCCTGCTCTGCGTCTCTCGTTATA
GTCCTCCGTCCTCTTCTCTCTCGCTATCGCTTTACAGCATGGGGAAGACATTCTCCCTCTCCTTCTCGCGCTCGTCCGTGAGCTTGAATGCGCCACTGCG
GCGCAGGCCGCGCATGACCGCGAGCACGAGGCCGAGGACAATCACGGTGGCGAAGACCGTCATGACGATCGCGACGTACACGTCCAAAGGCGCAAGGGCG
TACTGCTGCGCGCTGGCGGCAGCGCCGCTTTCGCCAGCTTTATTAATAATCGAGCTTACGAGACTCGACGTGCCTGTCGCGCCATCGACGCACGCGAGGT
GCTCGCCCTTGGTCGTCCACCACTTGAGCGAGCAGAGAGTCTTGGCGCGACACGGGTCAGTCGAGCACGGTGGTGCGCGGTGCGACTGCGCCTTCGTGTT
CCAGTAGTACTCCTCGAGCAGCGCCGGGTCGGCCTCGACGCGCTGGTAGAAGTCCGCGAGCGCCAGGCTGGAGAGGGACTCGAGGCCGTAGGTCCTGCAC
AAGTGAAAGGCATCACCACAAAGTCGTTAGTACAACGCTAACACAAATGCTCACTCACACAAAACACACTTACTCGCTCGCTGTGAAGAGCGGCTGCCAG
TCGAGCTTCTGGTCCACCTCCGAGATGTTCGTCCCGTAGACCGTGTAGTCGAGCACTTCGTACGTGGCCGCATCGTAGTCCCAGACCATGAACGACGGGT
TGTTGCCAAAGAGCGGTGAGATCGAGCCGGAGACAAAGAGCGGCACAAGCTCAAAAGCCCCGTCGTCATCACTGTCAGCGTCCAGACTCACGGACGGGAC
GCGAAACTCGACGCTATGCACGTGGCCGAACATCTGCGCCTTGATCACCGCTGCGTACTTGCCGACAATGCGCTTGTACGCGTCGATGTAGTGGACGTGC
CACTGCGGGTTCCCACCGTACGAGTCCACGATCGGCGCGATGTGGCCTGTGATGTACGCGAGCTTGCCCTGCTCCTGGAGCCCGGCGAGCGTCGCATTGA
GCCACGCAAACTGCCCAAACGGATCTTCGATCCCGGACGTGTCGGGCAAGTGGCTGGGCGAGTACGGTACCGTGTTGAGCGTGAGCACGGTCAGCTTCTC
GTCCAGCTCGTACGTCAGGTAGCCGCGCCTGTTGAACGTTTCAAAGTCCGGCGACGAGAGCGACTCGCCCCAGATCTTGGAGATCTTCTCGATCGACGGG
TTCACGTGTTTGCTCGGGTTCGTCACCTCCATGTAGTAGTCCGGGTCTGCAATTTAGAACAACCCTAGTTAGCCCACGCACATCTCTCTATAGTGGCACA
CACTCATACACACACAACGTACTCCCGTCGGCATTGCCGATGATCGCGGTCGTCTCGAGCATCTTGCTGTTATGCGGCGCGTAGAACTTTTCGATCGTCC
GCACATTCGTCTCGAGTGCCTTGGCGATGTACGCGTCCGAGAACATACCATGGGCCACGTGATCGCCCGTGTACAGGAACAGGTCGGGGTCTGGGAGCAC
CTGCTGCGCGTACTGAAGCGCGGACTCTAGCAGCGCTACGGGCGCGTCCCGGCCGTAGCGGAACGGGATCGCGGCCGAGTCGGCGGCATCGAGCGAGAGC
GAGAGGTTGAGGTGCACGTCCGAGAAGTGCAGGATCTTCTTGATGACACGCGGCGCAGACGTGGATGAGATGACGGCGGAGTCAGCGGCGAGGACGCCCA
GCGCTGCGAGCAGCGCGTGGACAGGCAGCACGGCGCGCACCATCGCGGCTTCCTTCTGCAGCTAGTGAGAGAATGAGAGAATGGCTATTTCTGGCTTTTG
GCTTTTGGCGCGCGTGCCAAAAATGGAGGTTCGAGTTTAAATCAGAGCATACATGTCCTAAAATAGGGATAAACATGTCCCATGTGAAAATGTAGAACAT
GCTAAATTAGGAGTATTTTCAGTGGTATGTTAAATACCCACACTTTTCTTAACCGCACTACTCACCCACTTATGATAAATTGCCTCGGCGTAGGGTCTAT
ATCAACCCCGCTCGGCTTAGGGTTTTGTGCAACTCGCTT