Description :
From Genome Similarity Track
Location :
Scaffold_127:14064- 15806
Sequence
1742 bases(100 bases per row)
AGCCACATCCCGATCCGTTCATTCCGATGCAAAACGAGGTCTTTGTCGCTGATGTTGGTAACCTGGTGATATCTGATCCTGCCGAGTCCTCGGACCACGG
TCGGCACCCAACGATCTCCACGGGTTACCCATAGCTTTTCTCGATCCGTCACCTTCATTTGTAGCGGAAGCTCGATCGAATCCCCGATCGCGATCTGCAT
TCCCTGATCTACACACACGTGTCTGACATTGTCGTTGTACAGCTGACGCCGTCCGCTAAGCTGGATCTTGACTTCGTCGGGGAGACAGATAGAGCCCGCC
GCAAGATCGAGGCGGATCCCCGCTGGAACCATAAAGTCCATACCCAGGATCGCCTCTTGTCCTGATAGATCGCCAACCCAGATATCGAAGAAATACACCA
GCAATCCCGCCAGCGTAACCTTGATCATAGTCCTTCCTTCCATCATGTACACGCTTTCGCCAATCCCCACACATTCCTGGCTCTGACTCGTGTCGACATA
GCACCCCACCTTACGAGCAAAGGCGGTGTCCACGATGGACACTTCGGCGCCGGTGTCTAAGAGTAAGATCGACTTCTCATTGTTGATCTTGCCGGTGATC
TTGGCCTGACGAAACCACTTACCTGGCGAATGATGTTTCCAGTACCCTCTGGACTCCCCAGGGAGGAGATCGGGCACCACATCGCCAGATCTGCGGTGTT
CGCTGACACGAGGCCGACTTCGATCGCGATCATGCTCCGGGATCTCGGTCGTCACTTCTCCATCAGCTGGCTTGAACCATTCCTCCGGTCTGCGTTGCTT
CCAATAGCCCCGCGTTTCTCCAGACTGGAGATCCAAGGGCACTTCGGCGTCAGAACGGCTGAAGTCGTCCGATCGATGTAGACTTAAGACCTTGGCGGTA
GATTTCGCATGCAGATCACATGTTATTATTCCGCGTAGATCAGTCCGTCCACTTACTCGATCTACCGTGTTCTTGTTCACGAATGCATAGATGCAGTACC
TAGAACGCTCGGCTCGTACCGGATTCCAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCGATCGCGGGCAACATGTCAGCGTGCTTCACCGGGTTG
ATCCATTGACGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCCATCTCGTGTAGCTCACCACATCCACGGCACACAAACAGGCAGCGATCCGCCG
GATGACCTCTCTTGCCACACTTCTCGCACGTCAAACGTCTCCAACAGTCGAGATCGGTGTGTTTCCGCGATCCACAATGTGACCAGCGGTTTGATCGCTC
CGATCCGTCAGGTGAAGATCGCGATCGTGGATCCGATCGAGGTGGGTCATGGTTGATCTGCGCCTGGTTGCTTCGATCCGGCTTCGTCGCGTCGCCCCCA
GCGTTGTGGGACATGTCCTCGGCCGACGCTAGGTAAACGCGACGTAGATCACCCTCCGAGTCTGACCCTTCCGATCCTGTGTCCGACCCAGACTCCTGGC
TCGCGATCTGAACCACACGCACTGCCCGCTTGGTTGCGGCAGCTGGTGCTGAGGTCGGAACTTTCTGACGATACTTCGATCCAAAGGCGGATCGCTTCTG
TCTACTCTTCGCGCGCTTTCGAGCGCGCAGGACTTCCTCCAGATCTTCCGCGTCCGCAAGCCGGAGTAGGGTGAGCTGATCGGCCAGTTCCGGATCGCCC
AGCGTCTCGATAAAGTGTTCGCCATGTTCTCGGCGGGCCTTG