Description :
From Genome Similarity Track
Location :
Scaffold_184:14062- 15399
Transcript NameFunction/comments
Albla_Nc14093270cytosol aminopeptidase putative

Sequence
1337 bases(100 bases per row)
TCCTAGTCTGCCATGTTATCCAATTATCAATTCGACAAGTATTTGACCAATCAGAATCAAGATGAAGATGACAAGTTGAAGTTGAAGTTGCCTTTACGAC
GAATTTCTTTGCGCGCACCAAATAACTTGAAAAATGTATTTTCTTAACGCTGCGCACTCTTTTCCTCTCAGCTATATGGAACTTTGTAGCACATCGAAGA
GCAAGTGATTGTGACGCAAGAAACGATCTTCGCCCGCAATCTCGGTACGTGTTTTACATTCACTCTGAGCATTAATAAGCGTCTCATTAGGAAATGAGCG
CGCCGATGTGATGACGCCCGCATTTATGGAAAAAATCGCAATGGAATGTATGGAATTACCCAATGTCAAAGTGACTGTATTGCAAGAGAGCGATTTAAGG
AAAGAAGGAATGAATATGTTTTTGGCTGTGGGTCAAGCGGCAACTTGTCCTCCGCGTTTGATCCTCTTACACTATGAAGGAGATCCGAATTCAACCAAGA
AAATCGGATTGGTTGGGAAAGGAGTCACATTTGATACAGGAGGACTCAATTTGAAACCAACCGGATCGATGGAAACCATGCATATGGATATGTGTGGTTC
AGCAGCTGTATTTGGAGCATTCCGTGCAGCTGTGCGTCTTGGCTTAAAAGTCAATATTATTTGTGCTTTGGGAATGGCGGAAAATGCTATTGGATCGAAA
GCTGTAAAGCCTCACGCAATTGTCAAAGCACATAATGGAATGACAGTCGAAATCAGTAATACGGACGCAGAAGGACGACTCGTGCTGGGTGATACGTTGT
CTTATGTACAGAAAATGCACAAGCCCAAGACACTGATCAATGTGGCCACACTTACTGGTGCTTGTGTCGGTAGGTATTCTTCCCTGTGCTCTTTTTACAA
GGTGATGTGAAATGTCAATGTGTTTGTAGTGGCGTTGGGTGAGTATGCTGCAGGAGTTTTCTCCAATGAAAAAGACCTCGCACGAAAAATTGAGGTTTGT
TGCTTTTATTGATTCCGTGGACTCGATGATAATTTCTATATTGGAAGGCTTCCGGGAAAGAATGTTATGAACGCTGCTGGCCACTTCCTATCTTTCCTGA
GCATTCTGCTGAACTCAAAGGCTACCAATCGGATTCTCGGAGCACCGGTAAAACACGATACGGTGGAGCCAGCGTCGCTGCTGCTTTCTTGCAACAGTTT
ATCGAGAAAGATGTTGCGTGGGCACACATTGATGCTGCGGGACCTTGCTCCTACAGTCAAGATCACCCAAATTTTCCCAGAGGCGCAACCGGATTTGGCG
TACATGTCTTGTATACGTACTTGAAGAATCATGAGCA