Description :
From Genome Similarity Track
Location :
Scaffold_200:14061- 16361
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_15853Hypothetical protein

Sequence
2300 bases(100 bases per row)
AAATGAGCTGTGCCATGTACCTAGAGCCGATAAGTTCTCATTTGGAAAGAAGAAAGAAAGAGGTCGTACAGGGCACGGACGATGCACTTGTACATGGCGG
GCCAGTAGACGCCCGTCGTGAACCGACCGGGTGCGTAGACGAAGAAGAAGAGCCGGCGGTAGACCACGTCCGAGACAAGAACAAGAGACCGCCAAAGTAC
CCGATAAGCGGCGTCATCGGGCAAAACACCAGCACGAGCAGCAAGACGAGAAAGTACGACGGCAGAATCGTGCTCTGGCTGCACGTCTCGATCGCCGACA
TGGGCGATAGCCACTTCCACGGCGACCGGCGCTCGCGGGGCGTCAATCGCGGCGCAAAGCAGTAGTAGAGGAACCCACGCAGGAACGACCCGACGCGGAA
GAGCTTGCAGGGCAGCACGAGTCCCGTGAGGATCGTCATGATCGAAATGTACAGCGATGCTTGCAGCGACAGCGCTTCGCTAAAGATGGTCACAAAGAGG
TACGGCGAGTCGATGAGCACGGGCAAGAGCGAGTTGAGCGAGCCGGAGAGGAGCGCGACGACAAACGTCTGGACAAACTGAAAGCTCACGAGCTTGGAAA
AGGTCGACGCGTCCACTTCCGTCTGCGAGGCCAAGCCCTCGCGCTTCGAGAGCGCGCCAAAGATATACGGCGCGAGGCCGCTGAGTGCCACGAGTCCGAG
CGGCGCCATCTGCTTGCAAAAGTCCACGAGCCACGGGTGGTCGTGCAGCGTCTGGTCGACCGACGTGTACTGGTCGCGCCACTGGTCCATGGACGCGAGC
GTCGTGACAAAGACCGTGGGAACCGACCACAGCACAAGGATCACCAAGGTCGCTAGCGTCGACACGAGCTGCCACGAGCTAAGGCTGTTGAGTGTCCGGC
CGAGGTTGTCCCAAAGAATGTCGGCCGGGTCCGGCGCCGGCCGCACGAGCATCTCGGACGGCGTGTCGGTCTGCAGCATCTGCAGCGCGCTCTGCGTCGC
TTGGAGCGTATTGAACGTCACAAAGGCCGACGGACGCATGAACGACAGCATCGTCGCGATCGGGATTGCATCGTTGTTCTCCGGCGCCTTGTACTCGTCG
TCGTGGTCGTTCTCGTCGTCTTGTCCTCGTCGTCCTCGTTGTTCGAGTCGTGCATGGACGAGACGCACAGCGCGTCTTCGAGACTCTCCTCGTTCATGAC
CTCGTGCAGCTTGGCTTGGTAGCCTCGCAGCGTCTCGATCTCGGTGCGAATGCTAATGTTGAGCTTCTCGAGCAGCTGACTCCAGTGGTCAATGGCGTCG
ACCTGGCCCCGCTTGAAGGACGTCGTTGGCCGATGGCCTGTCTGGACGGCGGTCACCATCGCGCGCTCGAGGTCGCCGCGGACGCGCTCGCGCTTGGCGA
CCTGCGCCTCGAGCTCCCGGCACTCCATCGCCATGTGCACCGAGTCGACCATAGTCGGGAAGAGCTTGTGGAGGTACTTGGTGAGCGCCTCGTGGGTGCG
CAGCTGCTGCGGAAGGTCGTTCATGATGACCGTGTACTGCTGGAGCCCGTCGCGGCCGAGGAATTCGTGGCGCCGAGAGACGTAGACCTTGTACTCGGCC
ACGAGCAATCGAAGCGTGTAGATGGTGATGAGAAACCCGGCAGCGACCGGCGCCCAGAGGCGGTTCGGGTCCAAGCTCACGTTCATGTTGGCCATGGCCA
GGCGCGCGACCATGTCCTGCGCGGTCGTCTCGTTGAGCGACTCGCCGTCGGGTCGGATGGCGCTTGCATAAATGGGCATGAGCCCAAACGAGAGCAGGAT
CGAGGCGCCGGCAATGTTGCGGCCGAGGCGCAGGAAGCGAAGGTAGCAGAGTGCGTCGAGGCCGCAGAACTCCATGATCTCGTCGTCCGTCGCGCGTAGC
ACGGGCGCGATCCAGCCGCCAAAGCCATAGACCTGCTCCGCCAGCGGGCACGAGGCCTTGGGGTCCGTCCCCCGGCAGTTGAAGTAGACAAGCAGGCGCG
GCCGCAGCAGCTCAAAGGCCACGAAGCCAAGCACGAGGAGCGACAAGTAGACCTCGATCGAGAGCAAGATGGATGCGTCTGGGTCCGTGTCGACGTGGTG
GCTAGCCATGGTGGTTCTGCCAAGAAACGTTTGGCATCCGGAGGTTACACACACTCCGGCAGCCAACGTCACGGTGGCCGGATAAACCTCCCGAACTCTA
TACTTTTCGGTATGCAATATAAGAGGTGAAACAGAAAACTGGGACGAAGCAGGTTGAAGTCGGGCAACATCTCCTCCCAGGAACAAGTGGATGGATGGTC