Description :
From Genome Similarity Track
Location :
Scaffold_359:14061- 15860
Transcript NameFunction/comments
g13862.t1hypothetical protein

Sequence
1799 bases(100 bases per row)
TGCCGATGGTCATATTTAAGCCTAGGATTAGTAACTGAACTGCACTCCATACTATAAATCCAGAGCTTCTCCGTGGGTAACCACGGCGATAGTTGTATAT
TTCAAAACTAGGATGCTACTGTATTTGATATCTCCTACGTCATACAGTACGCGCCGAAATCATAGCCGCACCGGACAAGCGGAGCTCTTGCGCCGGGAAC
TGAGAACTTCCTGCAAACTGAGGGCTCCGAGGCCGTCGTAAAGGAATAGAAAACTTATGCAGCAAGCGAAGTTGAAAAAGACCAAGATGGCTTGGAGCCA
GGAGGCAAAATCTGGTTTCAGGTCGGGTCAGAAGTATAGCCGCACTTGGAGGCTCTACATGCAAACGGCTCTAGTAACCTGTCTTGGCTCTTTTTAACAG
CTGCGTCGCGTCCAGACGCTTCGGGACGCTTCGCACTAACTTCTTAACATACGCAGGATCAATGCGAGACCATTCCAACTTGATCTGTCTGATCAAGTCG
GCAGGCTTGTCAAATTGGCGCCCGTTGGCGTGCACCCGGCGGGCGAGCCAGGAGACCCCACACGTTCTCTGTGATGTTCAGATCGGGGCTCTTGGCAGGC
CACGGCAGCGTTTCGATGTTATGGGTGGCTAGGAAGCCCTTGGTGAGCCTCGAGGCATGTACGGACGCGTTATCCTGCTGGAAAATTGGGGTCAAATTGC
CCAATTTTGACCCCAGTTCTCGAAGGCAAGGAAGCATGCTGGAGGTCAGCGTTTCGGTGTACTTGACAGAGTTCTGCTTCCCCTTCAGGAAGAGCAGCTC
GGTTTTGCCATGCCAGCTCACCCCCGCCCAAATCATGACGCTTCCGCCACCGTTGACCCGCTTCGACATGAGTTTGGGTTCTGCTCGCAAGTCGTGCCAG
TAGAATCTAAACCCATCCGGGCCATCTAAGTTGAACTTCTTCTCATCCGTGAACAGCACGCGTCTCCAAAAGACCCTTTTACCGGCGTAACGCTCCGCAA
AGCGACCCTAGCCTTCTTATGATGCGGCTTGATGGCAGGGGTGAGTTTTCTCTTCGCGTACGTGACGTAGCGGTTGCTACGCAGTACGCGGAGTACCGTA
GACTTGCTTGGTTTCGATGGTAGCAGTCCTGCGATCTCTTGGGCGGACAGGTTTCGGACAATTGCCAGTCGAATGACGCGCCTGGCCTCCCGGCCAACTA
TTTTCGGCCTTCTTCCTGTCCTCTTCGTCACCGAGGACGCCTTCCCGCGCTTCAAGTAGTTCCTTATAGCCTTCTCGTCGCGCCTGATGAGCCTCCCGAT
CTCTCGGTTGCTGTTGCCGCCTCTGAACTGTGCGTTTATCTTCATGCACTCCTCCTCGGTTAGCTGCTTGCCTCGTGGCATCGTTTCCAGCTTCCTCGCG
AATCCAAGAACAGATTCTAAAAGACCTTTTACAAAGCTGTCCACAGGTCTCATTTATTACGTTTAATAGCCCTTCAATTTTGTTTATTACTCCACTGAAC
TTTATAATACCAAGTGCGGCTATACTTCTGACCCGACCTGAAACCAGATTTTGCCTCCTGGCTCCAAGCCATCTTGGTCTTTTTCAACTTCGCTTGCTGC
ATAAGTTTTCTATTCCTTTACGACGGCCTCGGAGCCCTCAGTTTGCAGGAAGTTCTCAGTTCCCGGCGCAAGAGCTCCGCTTGTCCGGTGCGGCTATAAT
TTTGGCGCGTACTGTAGTCATACCTCGAGAACCTGAAGCGGCAGCGTTGAATTTTGTGTACGAGATGTACACCAATTTTGCCCTTTTCTGGAATCTTGC