Description :
From Genome Similarity Track
Location :
Scaffold_184:140591- 156563
Sequence
15972 bases(100 bases per row)
GGCGCACCGCTCGGACCTCTTCGCATCCGACTAGGGCCTGACACGCGTACCACGGAAGGGGAAGTGGTTTGCGGACGCTGTGGTCGTGTTGGATGTGGAC
GTGAGACGTGTCCCCGTGGACAAGGCCATTGCAATCGGTGTAACGAACTTGGACACTACTCGATGGAGTGCAACTGGCCAAGACCCCAAGGGAATTACCG
GAACGGAGAGCGACGCCAAGCGGAATGTCTGCTGTGTGGTAAGGCGGGTTACCTGGTGGCGAGATGCCCGAGCCTCGATACTTTGCGAGGAATGATGCAG
AGCGTGGCCGCTGGGAACGTGACTGCACCCGCTGGTACGTCCCAACAATGAAGGGGGCAGGAGGAAGGGGAAGGAAGTGTCGCTCCTTCCTCTTGCCTGG
TTGGCGACACGAAGAGAGATGAGGGTTCACCGCGACAGGACTTGGCGGATGGACATCAGAGGGCTCTCGGGAGAAGTGTGATGAGCGATGAAGGCGCACG
TGACGTTCCTGTCACGAGCGTAACGACGGAAATTGTGGAAACTATGAGTGGAACGAGCGGAGAGAGCAGTCCGACGGAACGGACTGGGCTAGAACGAGAC
GGAAAGAGTGAGGGCTCTACGGAGAGGCCCGCACGAGACGGAGTGGTCGCTGAGGTAACAACGGTACGTTCATCTACAACGCGGAGCTGGGAAAACGAAA
AGAGGGCCAGTCCTGAGTTGCTACAGGACATCAGTAAGAGAGCAACGGAACGCCCCGAGACTGCGTCAGACGCCAAGAACGAGTGTCTAGAGATAAAGGG
CTCTATCGAGAAGCCCGTACGAGAGAGAGTGTTCGCTGAGGAAACAACGGAACGTTCCTCGGCGAAGCTAAACTGGGAAAACGGAACAACGGAACGTTCC
AAGTCGGTGGAAGACGTCAGTAAGGGAGCAACGGAACGCCCCGAGACTACGTTGGACGCCGAAGAGAAGTGCCAAGAGAGTGAGGGGGTGGAGACGCTGT
CCACCCGCTCAAAGCAGTACGAAGGAGCACTCGAAACGATCACAGAGGACGCATCTGGCGCCAGGTCAAGTCAGTTCTCGGCAGTCATTGGACAAGTGAG
TACCGGTCAAGAAAGGACAGAAGCTCAGAAGGCCGAGGAGGACGAGGAACGTACTAAGGGGAGGGATTCGACGCAGCACTACGAACGCCTGTTTACCGAC
GAGAAGCTGGATATGCTGGAGCACGGTGGCAGCCAGGTAGTGAAGAATGAACCCGAGGAGTACGAGAAGGAACTGGAAGAACGATTGTTCCCGATGAACG
AAGAAGAGGTGCTGCTACGTGCCAAGCGGAACGCGGATGAACAAGGGAAGCCGACACTCGCGGAAATGAGTGCCGAGCTTAAGATACCGGAAGACGTGTT
GGAACGTACCCGGGAGGTCTCATCTGGAGATCTCGGAACGCCAGAGTATTGGCTGGACTGGTACGCTCACACGCTAGAGACGTCGACTGAAGCGAATCGT
GCCAATCGGGACTTCAAGGATGTCGGAGGAACGGGAGAGAAGTCGACGACGGTCGTTGGTTCCGTTACGACGGACGAGGACGAGCGTAAGGGTTGTACGG
AGATGTCGGAGGACGCACTGGAGAACGAGTTCGTGCAGAACGTTTGTGTCGGACTCGAAGAGGACGTCGTACCAATCTCGGAGCTCCCTGCAGAGGAGAA
GGGAACGTTACCATTTCGGTGGCGTTCCATAATTCGTAAACGAGTATACGAACTCCTCAAACAAGAGCAGAACGCTACGAAGGACCGTCCATCCGACGTT
CCTGAGAGCGGGGAAAACGGTGATGCTGAAGACGACATCCCACCCTTGCGCGACAAAGAGAGCAGAGATTTCTTGGACGAGGACTCATTCCGAGGATACC
TCGTCGAAGTGGGTGGAACGCTGGCTGAGACGTTCCAAAATCGAGCGTTGGCCTGGGCACGTGACTATTTCGAGACAGAAGCTTCCGTTATTCGCGACAA
GCTATGCGACAGACGGGACGAGACGTCAAAAATAGTGGCTGCGACCGTTGCGACAAGTTCCAGGAAGAGGGTGACTTTCGGTGCGACTATCAAGGACGGA
GATCCCAAAATAGGAGAAGAGGAGCCCGAGGTTTATTCCTTAAACGTGAGAAGAGCTCCCAAGCCGCGGAGAAGCCCTGGGCTGCGCGAAGTGAGCGGCG
ATGACGTCTTCGACGACGGTGAAAGTGTCGTGCCGGATGGCAAGCGTGTCATCTGCAGCGTCGGTGGCGTGCAAGCGCTGTCGGACGGCTTTATCGATTG
CTGCCCGTCCGAAATGCTAGCCGATACAGGTGCGGTCGCCAGTCTCGTCCATAAACGCGTGCTGAAGCGTCTCGGACGAGCCTCCGAACCTCTACGACCT
TATACTGGGGGCTTGGTATAGTGTCTCGGGGCACAAGATTCGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTCGATTAGCACAAGGAATCGGAGTCTGGAGAAAGGCTTCTCTTCACATCTAA
AAAGTGATGCGTGTTAGTCGGACGTTCTAGCTCCATGGGGGCACCTTCTTAAGGAGATCTGATAATGGCCGATCCATCTCCGCGTAATTCGCGCTGTTCT
TGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAGCCGGCCAGTCCACGATGGCCTTGACTTTGGCAGGATCTGCCCG
TAAGCCACGCTTCCCAATGGAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCCAAGTTGGCATACAACTTATTAGTGCGCATGCAC
TCGAGCACCGCTCGCAAGTGGTCAATGTGGTTATCCACGTCTGACTTTCCGTGCTCGGCACGACTATGGACGAATATATCGTCAAAGTACGTCTGAGCGT
ACGCCCGGTGGGGCCTAAACAACTGCGTCACAAGACGATTGAACGTTGCTGGTGCGTTCGACAGCCCCTGGGGCATCACCAGCCACTCCCAGAGCATACC
GCTCGGAGTACTCACCGCTGTCAGCGGAATGTCGGTCGCTCTCATGAGCAATTGGTAGTAGCCATCGACCAAGTCGAGCGCGCTGTACAACGTACAGCCT
ACCATGTTGTTCTGCAGAACATCCTTGCGAGGAATCGGCGTTTGCGCCGGGATAGTGGCCGCATTTAGCTTGTTAAAAGCATGAACAGTGCGCCACTTGC
CGTTCGGCTTTCTGACACAGAACGTGGGTGTCGAGTGCGGAGACTTACTCTCGCGCACCATCCCTGCCTCGTGCTTCGCACGGAAGAATGCGTCAATGAC
GTCACACTGCTCTCTCGGCAAAGGCCATTGCCTTGTTACGCAGTATTTGGTTCCAGGAACCAGGTCAATCTCATGACACACGCCTCGATACGGAGGCAGG
CCCGTTGGTGGGTCTTTCGAGACAACGTCTCCATACTCCTTCACCACCGGGTAGAAGGGATCCGAAGGATCTTTGAGGATCGCCGATCCACTTCTTGCGC
TCAGCGCCTTCTTGGTTTCCTCTAGGACCGCGTCGTCCACGACGGATGAGGAGTTCAACTCCTCCTCAGGTCCCAGCAAGACCACCTCGGCTAGCTCGCC
TGCCTTTAAGGCTTCGCCGAACTCGGCAATGGACATCTCGTCCAGCTCTAGCAGAGCATCTGCAGCGGGCAGCAACCGGATGTGCTGCCGTGGCCGGCTG
CCTTCACTGCGGGACTTCTGCTTCTTCCAGCCGTGAGTGCAGATGTAGGTGCGCAGATAGGAACCGAATCCCTCTGGAGCCAGCTGATTTTCATCCACGC
CTTTCTTAGTCTTCTTTAGTCGCTTGCTTCGCTCAGCACGTGACACTGTCTCCTTCGCGGGAACAACCTGCATCGTTCGCCGACAGTAATCGATAAAGTA
CGACTGCCAGGCTTCCCAGTTGGCATAATACTTCACGGGCGTTGCCCAGCCTCTACATCACGATCTTCTTCTACATCCATACGTTCACCCTCCTTTAGGT
ATTTGTTGCCACCTGTGCGATGTCTTCGGCGTTATCTCCATCATTTTGCACGTCAGCTCCGGTCCTACTCCAGGCTGTGAAGCATATTGCTCTGGACCTA
CACGCATGGCTTATTGCACGATCGCGTCGGTCGGAACTCCTGCAGCAACGCCGGTATCGTCTTGACGCATCTTATCGCTAGCTGGTAAAATGGAAAGGAA
ACGATACCGTTGGAGAATTTAATCTCATCGGAAATAAACGAGTCGGTAAGGAATCGAGCCGGTATGAAATTTTATTTATTTCGCAATTGTGGAGCTAGCC
ATGACTGAGTTTTATACAGTTCCATGTCAATAATCCTGGCTTCCAACGGTTGTTTATTAATCGACAGAATATCATCGACTTTTATTTGTTTACATTCTTT
TAAGTTATAGTATTATTCGGTTAATTTGGAGTAAAGGTATGACACTATACGGTAAGTCCGCAGACGAGTGCAAACGCGCTGCATGAACGTGCTGCGGGCT
TGCCGTATTCCCTATGTGCTTTCCTACGGATTTGTTTTACGGACAGCAGCGAGTAGCTAATAAAAATCAAGCCTTAGTCGTACTGGCGCAGCTATGTACT
TACAAAAACAAACTTTCAAATTTTTTTATTTTTTCGCGCAAAAAGTGGCCAGCCGGGTGGAGTTAAGCCCATTCTTGGGGGGCATCTTTATTCGATATAA
GAACGTGGTAAAGGCCTTAAAGAATCTCTATTAATTGATTGAAGGGTCCAAAGAACGATCCGAATACAGCGCTTAAACATAGTTGTAAAATACGTAATGC
AAATTTTGCAACTATGTGTCAAATTCAATGACCGAAGTAGTTCAAGCACCATAGGGAATTTGCATAAATAGTACCGTTAAAAGGAACTTGAGAATATGAG
CGCTCTTAAACTATTCATGATATTGCCTGAATTGTAAAACTTACACGTGAAATTTAAAATCGGGGCCGGAAAATAACCAGTGTGTACACTAAAATCTCAA
CTAAGTTCGAAGAATATCGTCAAGTGCGATGAATCCTGGCCGTTTAATTTTGAGGTTCATTCGAGAAATCTGAGCCACGTGTCGAAAGCCGTCACACACG
GGAAGAATTCTACCTGTTTTCCTGCTAGACGATCGCTCACTGACGCGACAGCTGACTGGAGATCGCAACTTAAATGTCTGAAGGTACGTATCACAGCTTC
TTTGCTATATTTGTGGTCATTACAAAAAAAAATCCCCAACGTTAATGCTTCTGTTGTTTAGATGACATAGACGCCCTTTTCGAGCTGAGCTCTTCTTCTT
CCGGGTCTGAATACGACGACCGTAATGTTGACATCACACTTGATAGCGATTCGAGTGATACGTTGCAGGAACTTTTGGACGAAATTGGTTCGTGCTGTAT
TGCGAAAAATTATCGTATATGACTATAGCTTAACTGTTTTTGATACTTCGGACAGATACAAGCCGGGCCTCCAAGAGGAAAAGTCGTCTGTGTGGTGTTG
GAAATCCCACGTGAACTCTAGCTACAGATGTAGTTAGGATGTTCCCACAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGACCTGAAGACC
CCAGTTCTGCCCTTGCACCGGGACAAACTGGACCTTGTAAACTACTTATATAGGCCAACCAGTAAAATAAGAACACGCTACTAGCACGAGCAAAGCTAGC
AGGTGTTTTGAATCCTTGTGGTCCCAACAGCAAAAAGGGTACCAGGCACGGGTAAGCCTTTTACGAGATCACCGAGTGTTTAACACTCGGCTGGAAGAAA
TAAAAGGGAGGCAATTCAAGCACTCCCAGTCGTGCAAATAGGCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN