Description :
From Genome Similarity Track
Location :
Scaffold_366:14059- 16594
Transcript NameFunction/comments
g5146.t1hypothetical protein

Sequence
2535 bases(100 bases per row)
CTGCTTCCTTCAGGAGACTCTTGTTCCTGAACGCCAGTCGCTTCACAAACTCAGTCTGGGAGCTTCTCGGTACTAAGGTTTTCAGAGCTCCGCGAGTTCG
CTGCAGCGCCACGAACACGATTGAACTGGTCAGCGTTGGGTGTGAGGATGGCGGCATGAACGGAGGAATGGCCGCAGTAACACGATCTTCTCCGAGACGG
AGAGCTTCTTGAAGTGCTGCGACAACAGTTGACCTCACCTCCTGACGAGTCTTTGAAGTGATCAGCATCTGGAACGAAGCACGGGCGGCGGTTGCAGCGT
CTTCATCTTGTGTGGCTGTCCGCCCAATGGAGAGCAGCCCGCTCTCGGACGCACATCGATCGACCAGCACATCAGCTCGTGGAGTTACAAGTTGGGCCAT
GACGTGCTCACACACGTCTGTCGTCACGTTTCCCACAACAAATTCCACTACCGCCTTCAGCTTCGGATGCACCTTGAAAACCGCCTCGGAAAGCTTGTCG
TTTTCTTCCTGGAGCGGCGATAAAGTGCCGGGGAACGCCGTTGTCGGTGACTTCACTCCGGAGGTGGCTGAGTACCCATCGTTGTCATGCTTTGAAGTAA
AAGACGAGATACCACCGTTCTGGTCATCCTGGATCACCACCTGCAAGGGTCGGAGTTTGCGGATGGGTGTGACCAGCTGGCCTTTAGTTATTCGTCCAGT
GCCAGTCGAGAGTTTCCTGCGTGGTAATGGCTGCGCACGAGTCTGAATGAACCCACGCAAGTCTTCCAGTTCGCTCACGCAGCTCTGGACAAACACTTGG
CTGTACAGGAATGGCAGGTGATCTTCTCCTTCTCCATCCTCTGACGAGACTCCACCCTCCTTTGTGAGCGCCAAACGCACGTTAGACGGCGGAAGGAGTT
CTTCAGACAGATAGTCGCCGTTATGTATGAAGCCAGCGTCCAGCTTCATTACGTGGAAGATGCGCTCGATTTGCATCGCAATGTAGAGTCCTGTCTCGCC
CAGGGAGTTCAATCGCGGCGACCGATACAGGAGCTGCAGCAACACCACAAGTTGCTTGAAGTAGGTCGTTCCTGAAGACAGTTTATCCAGCGAAAGCATC
GTCAGATAGTCACACAGCCATGGAATGCACTTGGAGATGGATGCCTGGAGGATGCTGTTCTCCAGCAACTTCTTAACGTCGAGACTGGAGTCGCGCGCCA
CCTCTAGTGTGCTGATTCCTTCACGCTCGACAGCCTTGAACGCAGCATTTTGCTCAGATAGCTGGCGAATCGAAGACGTGACTTCCCATTGCGGCGAGAA
GCGCAGATATCCGAGGAATTTTGCCATCACCTTGAGTCTTAACACCAGTTCTGTGAAGTTGTTCCGAGCATCAGCAGAGGGGGAGGTGTTTTCTCGAATG
GCGTAGAATTGCCGCTCTAACTGGTGTTTGACAAGCTCGGAGAACTCGTAGCTATCACAACTGTGCAGGAAGTGAAAGAAGAAGAGCTGGTTGTCCGTAA
AAAAACTCTTCATCCGATCAAGCGTTGCCGTGAACTTTTTGGTTGCGTCGTCTTCGTTGGTGGTAACTCTCGTGTCCTGCCGGGGTTTCCATGGCGAATT
GTTGTTTCCCTTGGCGCCAGTCCTGTTGTTGCTATTGCCTGAGCCGTTCGAGCCGGCGTTGTCACTACTGGTACGCAGATGCGGCTGCGGTGACTTATTC
AAAGGCTTTTGGTTTGAAAAGCGCCGATGCAGCTTGCGCAAACGGTCCGGGTTCTTCACCACGAGTTTATCCTCCATGATCTTCAGCACAAGTTCCTTAT
CGCTTTCACCGAAGGGGTTGGAACCCACTTGCAGTAATTCCTGGACGAAGAATTTGGCGAACCACCACCTGTTCTCAGGAAAGACCTCAGCTAGCAACTC
CCGCGCAAGCGCAATAGCTGCTGCTGCCACACCTGCATTCTCGATGCCGACGAGACTGTGCTGCTTCTGCTGGAATTGACGCAGTAAGCTGAGAAAGCCG
TCCCGGACCTTCTCGCGGTTTGTGTACAGGAGGGATTCCGCCGGCGTCCGGTAGTGCAGGCGCGAGTCGGTCTCTTCGTTGAAAGGGAGTGCGAAGTCTC
GCACGGCACTTGCTTTCATCTCAACTGGCAGCTGACAGCCGACTCGAGCACTTTCAGCCACTCGGAGCTCCTCGCGCTGGCGAGACACTTGGTCAAGTCG
CTCCAACATGGACGAGCAGATGCCCTCGGCGTCGTGCAGGCTGTGCTCGACTAACTTGAGCAGGTCCGAGCCAAGATGTGTCAGCACCGGCTCAATCTCA
TGAAACACGATCTCTGCGAAGTCGAGACAGTGGTCACGCCAGCAAAACTCCGACGGAGCTTCGCAGTTGTTACCACCATCACTCCCCGGCTGCTCCTCAT
TGCTGCTGCAAGCCGTGCAATTGGCCCGATACAGCAGACTAATGAGCACCTGCAGCTCGGCGCACGTACTGCTCACAAACCGCTCTCTGATCAAAAACCC
GTACAGCCTCGCCGCTTGTCGGTTCACCTTGAAGT