Description :
From Genome Similarity Track
Location :
Scaffold_60:14055- 19283
Transcript NameFunction/comments
g18472.t1hypothetical protein
g18473.t1ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
5228 bases(100 bases per row)
TGGCTGTTCCCGCGTCGGACCCGCACTCCTTCTGCTGGCACCTGGAATCCCGACTTGATCACCCAGGCTAATATCTTGGCGTTGTATAAACTGCGACCAT
GGATTGTGTTGGGTCGGGCAGTTCCGCCGCGATCGTTTGATGCAACAGGATGGTTCGCGGAGTTCGTACAGTTGTACGCGGCATTCGAAGAGGAGTTTCG
TCAAGCATTCTGGGAGTCTACCCACAAGCTACCGATCACCAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTAAGTTTTGGCTCGGGTGCAAACAGCGT
CGATCTCGCGCTGGGCCCCGGTGGCAGACCATCCTCAAGCATCTACTGGCTGGGATGATCGCTGGACACTGCGATCTCGACCTGCTTCTGGATCCCTTCT
TCCTTCATTTTCCGCGCCAAAACGAACGGTGCTTTTGGTACCCCGGTTTTGGAGCCACGCGGGCGCCCCCTGACTTAATCAACGCTCTTCCTACCGCCGA
TTCTGCCGACCCGTGGCGCAACCAATATCGCACACAACTGAGCGACCATCCCGGGTCCCGCATCGCACGCCTAGACGGTAAGTTTCGGTCCATCGTCGAT
TCTGAGTGAAGTCACCCTCTCCAAGGTCTTGATAAGCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATTGGGTCACCCGACCCCGATCGGCC
TCTTCCTTCCCCGATCGCAAACTCACAAATCACAAATTACCCCTTCCTCCGATGTGCGGCCATCCCGCACATCCTTCATTCTCCTCCTCCCCTACAGTGC
CTGTTACTGCAGGGGGTCTTCCGCCTCCCCTTCATGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCAGTCCTCGTTCAAAGTCGCGCAACATAGCG
CCGCAATTGAGGTCCGCCTCATCGACCCAAGTTGGATCGTCGTAACCCTTCCAGAACACCAGAAAAATCTCGGTGGACTCGTCCGTAGCGCGGCCGGCGG
CCGGTTCTTACATCCGCGATATTCTCCACTTCAAACTCGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCCTCCGGCAGGAGGACCTCATCGAAGTCCAGGC
GATCGCTCTCGGCCACAAGCAACGGCGCGTCAGGACGATCGGGAAACCTCCGGACCAACTTCAATTTGGACACATGCACGATCGGGAAGATCCTATACTC
CGAACCCGCGATCTCAAGACGTGCGGCGTGATCGTCGATCATCTCGGCGACACGAAAAGGTCCATGCCACAGGTGTGCGAGCTTCCGTGCATACCTCTCC
TTGACTCGATCGAGGTGTAGCCATACCTGAGCGCCCACCGCGATGTCGTGGGGTCGCAGATCTTCGTTGTGTCGGTTGGCTCTGCCTCTGATCGCCTCGC
GCAGTCGCTCACGAACCTGTTCCCGCGCTCGCTGGTAGTGTTCTTGTACGTGGTACCTCCATCGACGGGGCTCCTGATCGCGTCTGCGCGTGCTGCCTAA
CGGTAGCGCTGCCTCCAGTGTCGATCGCGGGTCCCACCCATGGGCCAGGTAGAAAGGCGTGTCGCCACGAACTCGATCCTGGGCCGTGTTTAGAGCGAAC
GTGAGTCGCTCCGCGTACTCGTCCCAGTCTCTCTGGTTCACGTCTGACACGTACATCTTCAGCGATCGCGTCAGAGTCTGCACCATTCGTTCGGCAGTTC
CGTTGGCTTGCGGCCGGTATGCCATTGTAGCTCTCTGTTTCTGACCCACTATCCGGCTAAAATCACGGAAGAAATCTGACATTAAACCGGGCTCTCGATC
ATGGCGGATGACCTCACTGGCGCCGAAACGTCGAAAGACGCATTCTTCGTAATTCTCGGCGATCGTTTGGGCAGTGCGAGAGGCGCTAGCCTTCGCGATC
ACGTATCCGGTGAAAAGGTCAACCCAGATTAACAGCTCTGTGTTTCCTTTGTACGACTTCGGTAGAGACGGAATGTGGTCCATGGCGATCATTTGGAATG
GGTACGTAGCTTGTACATTCCCTGGCGATTCTCCCTGAATGAGGGGGCGCCCTTTCCCAGTTTCACAATCCACACATTCTCCCACGAACCGCTGAACACT
CCTGAACAGCCCTCTCCAGTGGAAGTGCGCCTTGACACGCTGGTAAGTCCTCCCGATCCCTTGGTGCCCGCCTTCCAGGCTAGCGTGGTAATGATGCAGG
ACGTCTTGTTGTAGCGTCTCCGGGATGACCAGCCGCGCGAGGGAGTCTCGGTCTTCGTCCGATTGCGGTTTTGTCGGGCAGTACAGCAGGAGTCCGCTCT
CGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGACTTAGCATCGTTCGACGACAGGTCGGTCACCTCGCCCCGCAGGTACGATTTCATGTTCGCGAT
CCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTCTGATGCGTTGCACGATCGCTTCTTGCAGAACTCCGGCGTTCGTCTCGACCGTCGTGCCG
ATCGCGTCACGAGTTACAGCGTTATTATCCTTCGGCTTCAGGAGCTCGTCCAGCCGATTGAGTGTGATCAGGTCCTGTCGATCAGCTTCCGAGGTAACTA
CGGTTCCTTCGCCTCGTTGAAGAGCTTCGCTAGCTAACTTGTCCGCACTCTGGTTCCAATCTCGTTTCATATGTAAGAACTCGTGTCTTGGCCACGATCG
GAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGGCCAGGGGCCTTGCATGCGATCTCACCACGCATTTGCCGGATCACTAAATTGGAGTCACCACAG
ATCACGACCCGCCCCCTGTCCATAGTGGACAGGAGACCGAAACACAACAACAGTCCGCGGTATTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCG
ATGCGGCCGTGACGATCGTCCATCCCGGCAGCCTCCACACGATCGCGCTATAAGCGCCACCACTGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGAC
CAGCAAGGCTTCATCCGCTTCGACCGTAGGGGGTGGCGTGGTGATCGTCTGTCGGGGCTGCTTCACTGGGGCGATCGCGATCAACGCCTCGTCTACCTCT
GCGCGAGGTGTGATGCTTGCTGCGATCGCTCCCAGAATTTCATCCTCCCCTTTCGTGCACTTCCTGATCTCTAACGTCTATTCTGACAACAAAGCTGCCC
AATTTCCCAGTCTCCCCTGGAAACCAGCCGAGTTGACCAGCCACGCCAGCGTCGAATGTCTGGACAGCACCAAGATCGACCTCGTCGCCAACAGTGTATA
ATTCACGTCTAGCATCCGCAGGAGTGCCAAGACTTCCTTGTCGACCATCCCGTAGTTGATCTCGTTGGGCTTCAGAGTACGACTGGTGAAGGTTACTGGC
CAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCATAGACTACGATCACCGGGGTGCGATCTGGATCGAAATGTTTCA
GTACCGGGGTGGACACGATCTTGGCCTTCAGCATCGTGAATGCGATTTTCGCTCGGGCCCAACGGTCAGCATCTTCTGCTCGCGTGACAACGCCCCCAGC
TACTTGTTCGCCGGGGATGGACCTGTTCTGCTGAACTATCTCGTGGAAATCCGCTTCGCGCAGCTCGTACAGGACAGCGGCGTAGACCGCGAAGTCTTCG
ATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGAGTCTGCGGGAAGGGAAGGTTGCCTAATACTTCAAGATCTTTCGGAT
GGGCTTCCAAACCGTCGACGGACACTCGGTGTCCCAAGTAGTCTACTTTTCGTCGGCCCCAGAAACTTTTGACCACACTGATGGACAAATTCCATCGTTC
GCAAGCATCGAGCAGTGCTTCAACCTTCTCACACAGCATGTCCCAAGTGATCGCAGTCACCAGAATATCATCGATGTACGATCGCCTTCCCAACACTGAC
GGTCTCGGCTCTGGTTCTGGCTCGCCTGAATCGAACACATCGATCGGTCTCGACGGATCGTGACCGGCGCGGATTCGGAAGTGTCCATACAGCGCGTTAT
CAATCAATCGCTGGTAGATCTGTGGCGCATTCTTCGACCCGAAAGGCATACGCGTCCACTCGAACAACCCGAACGGTGTGATGAACGCAGAGATCTTCCG
TGCGCGTTCTGTCATGGAGACTACCCAGAAGCCACTTGCCATATCGAGTGAGCAATACCAGAGCACTTTGTCCAAGTCTTCCAAGAGATCGCTAATCAGC
GGCATGGGGTACACCATCAGTCTCGTCAAACTATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCG
GAGAGGCCCACGGTGAAGTCGACGGCGTGATCATCTTCGCCGATAACAGGCTTTTGATCAGATCCGACAGCTTCTCACGGAACTGTGGAGCGACTTTTCG
GACACGTTGTGCAACAGGAGCTGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCAGCTGGTGGTAACGCGTTCCCCTTCCCGATCAGGAGATGT
TTCCGCCTCCAAATTATCTGTCGCAGGCGATCGATTTCTTCCGGGGTGTTTGACTCAGCATCGCCCACCTGGATATCCTAGATCGTGACTTCATCGGTGG
TGGTCACTACTTCCGGCAAGATTGCCATCTGTCTCTCCACATCTTCCGCGAACAGGTCGCCACCTTCGTGGTAACATACTTCTTCGTCATCCAGCGGTTC
CGGATTAACGATCAGAGGCGTTTCGGCCCGGGGCATAGACTCCTTCTGGTCCGCAGTCATCTCGTTTCGTGTGGCCTGCTCCATTGGCGGAGATTCTCTC
GCGTCCTGATCGCCGGTGCCACCTTCCTGATCCCTTGGAGACCCCTCAGCTTCTGGTTTCATCTCGGCGGGTCGAGGCACGGTTAGTTGTGCGACGACCG
ATCTCGAGGTTCCACGGTCACGACGCAGGATTTTCATCGGTGTGTCGTACTGAGGTCGATCTACCATGGGTCCGGTAGGAGCGAGTTCATGCTCTTCTAC
CTCCACATGGTCTGTAGTAGACTGGAAAGCTAGATTCTGCCACTCGGCATACCTGCGCGATCCAAGTAACACGAAACCGGGAGTGCGAGGTACGCGTCCT
CCTTCAAGCCACATGCCGACATGGGTGT