Description :
From Genome Similarity Track
Location :
scaffold_178:14055- 15891
Transcript NameFunction/comments
g778.t1 PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
1836 bases(100 bases per row)
CCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGATGGAGGGCCGCATGCACCACGTGGTGCAT
GTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGCCGTGC
AAGCCACGGCATGCCCAACACCATATCGAACTCCTTCTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCT
AGCCTCACTTCCAATAGACTTCGAGGTGTTTCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCCA
CTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGG
GGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCC
CGTGACGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACG
CACATTCGTTGATCCACGACGCTGCTGGGAACCAGCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGC
ATCAGCCGTGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTC
GGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCGATCGGGTTGGTCACGATGTTCGAGACCAA
GTACCGTGCCCTTTGGGCGTAAGCATGCACGTTATAATTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAAC
GCTTGTTTGAGCTCCTCCTTGAACTCTTCGTACGTGCTGAAGCACGTAGGGTCCGTGAGTCGGTGTCCGTACGCCCAACTCCTTGCTCGTCCGCCAAGAC
ATGACATGGCGGACGCAACCTTCGACAACGGGTCGACGATACGCCGAGCCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTC
TCTTCCAACGTAACTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGATTCACGCTGTTCCTTC
ACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGA
GGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGG
CAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCA
CTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCATAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTGAAACCTAGAT
AAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGA