Description :
From Genome Similarity Track
Location :
contig_1:140529- 142500
Transcript NameFunction/comments
g28.t1hypothetical protein

Sequence
1971 bases(100 bases per row)
CGTCGGCTCACAGAGCCGACGCGTCTTCGTTACCTCGACGCCTAATGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCAGTCGACACGACCGC
GTCACTCCGGACGCTTCGAGACCTTCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCATATTTTCTTCCAACGACTCTCGCAGTCGTTGTTGTT
CCCTCGGGGTGATTCGAGACAGCCGCATTCCGCGCTGTCTTTGATGGAGGGACGCATGCATTACGTGGTGCATGTGCTGCTCCCGAAGTGCATGATCGTG
CGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCCATACCATATCGAACTTCTTCTCTTGATATGAGAAGCGTACACGTACGA
TACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGACTCTG
CAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACCTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGATTCGGCTTGTCA
TATTGCTTCTTGCAGTGATATTGACTCTCACTGGGGGCAGCGATCTTCAATACAGCGTGTCCAATGTCGACACGCTCGACCGCATCACCAGCAGGACGCC
GGGCGCCCTGCTGGTCCCTCTAGTGTTTTGTTAGCCTGTGACGATACCCAGTATCGCCACGCGGCTCCTGGTCGCGCGCACAGGTGCTGTGCCCTCGCGG
GCGTAGTGACCGATGTGTCCGCAGCGGAAACAATGAACATTCGTTGATCCATGACGCTGCTGGGAACCAGCAGCCGTCGCACCCGAGAGGTTAATTGGTT
CCGGTCCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGCGGGACGCTCACATGCAGTTTAGCCTCGCAGGCTAAACTCTTCTTGTATTGCGAGCC
CAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGTCTTCATAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCTTTGTCGCCTCG
TCGATCGGGTTGGTCACGATGTTCGAGACCAAGTATCGTGCTCTTTGTCCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCTGCCC
TCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAACACCTCGTACGCGCTGAAGCACGTAGGGTCTGTGAGTCGGCGTTC
GTACGCCCAACTCCTTGCTCGTCCGTCAAGACATGACATGGCGAACGCAACCCTCGACAACAGGTCGACGATACGTCGAGCAGTAATGACAGTGTCGGCC
TCGACAAGCCAACGGAAGAGAGGTTCCCCCTCTCTTCCAACATAGCTGCTTACGTGGAGTGTCAATGACTCCACGCGCGGTGTGGCCGAAGGCGACACCG
AAGCTCGAGCAGTGGTTTCACGCTGCTCCTTCACGATGAAACCCAGAACAACATCGTGTTGCTCCGTCGGTGATAGCGTACACAACATCGTTGCTACCGC
TGCTTCTCCAATGACCGTCGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGATAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTTCAGACGTGTTT
GGGCTACCCACGAACATGTTACTGTCCGAGGGTGCGTTCTCAACCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGTTGGACGGGCTACAA
AGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTTAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTATTTACCTTAGATCCAG
TCTACTTGTATCCACAAGTATACTTAAATCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGA