Description :
From Genome Similarity Track
Location :
Scaffold_1342:1405- 2461
Transcript NameFunction/comments
g16565.t1hypothetical protein

Sequence
1056 bases(100 bases per row)
CCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTGTTCCTCCCGCTCTGGATACTCGACCAATGCCTTGAATCTCGA
CCTCGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCC
TTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCAAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGC
GCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATAGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCAGACGCGTTCCGTTGCA
CAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTG
AGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGCCCAGTCATGCGATCCGCTATGGCTT
CGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACAT
CTCGTCGATCATGCGCCGCATACCTCGCGGAGTAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCACGT
GGAATCTTCATGTAGTCATTTCCCAGATCATTGTGTACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCAC
TATCGGACGTGGCAGCCGTATGTTCTCTGTCAGACGCACCGTATGGAAAAGTGGCCACCGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTCGCC
GAGCCGCCCTTCACCACCGGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCAC