Description :
From Genome Similarity Track
Location :
Scaffold_606:14049- 20714
Transcript NameFunction/comments
Phypl_g9752hypothetical protein
Phypl_g9753hypothetical protein
Phypl_g9754hypothetical protein

Sequence
6665 bases(100 bases per row)
CCCAGTCGCTTCGCCACAACCATCCCCTGGTCCTCAGCGAGGCCGTACGGCGGCCGATCTGGGCACATTCCACAATCCTCGTTGGACTGACCACCTTCAG
CTTCCCTGCCCCAGCGATGAGCGCCCCCGGTCAGCCTCCAATCTCTTCGCCAAGCGCACCCactgcggcgacggcgtctgcgACTGCCTCTgcctcttgc
tcttcttctccggcGACTGTCGTGCCCACCGCGCGGATCGCGCTGCCACCACTCCATCTGGATGCGATTCAAGCGTCTCTCACCACGATCAGTCGAGCGG
TGGAACGCGTGGCCGCTCAGGCAGCGCTGGAATTGGATCACGCCACTCTCCGAAGAGACTATCAAGCCGAGCGCGATCGCGCGGACGCACTCGATCGCGA
ATTGCGGGATGCTAATGCGGCAGCTGCTCCCTTCGTCTAGTTTTGTCAGCATCGCTACGACTTGGtacgccacgagctgcgggaATTGCGGACCTCATGG
GCCGAAGCACTCGATGCTCTGGTCGATCGGCATGACAACTTTCGGGAGATCGCCGCCATCCGCGATCAATTTCGCGTGGAACGTGACGCTCATGAGGAGG
TCGTCGCATATCTTCACGCGCAGATCGACGATCTCAAACTGGGCACGAACAACCCAGCCCCGCCTAGGTTAGCGCGGCGTATATTGGCGTTGCAGGGCGA
GGCGACTATGGCGGTTGTTGACCGGGATCGGGCCCTACAAGATCTCCGCCAGGCGCGCGACGACATCACTGCCTACGAGACTTCACAGAAGGCTCTGGAA
AATGCTACCGGGAGCCTTCAACACCAGATCTCCACTCTGGAACGTCGAGTCAGCGATCTTCAGGCAGGCCATGATTCAGATGCCACGCGTCACCGACGAC
AGCTCTATCGGGCATTGGGCGAGCGCGATCGCTTCCACGTTCGGGTTCGGGACGTCGAGGCCCAATTCCATCAGCTGTCTGCCGATCCCCGCCGTGTCAC
TGCGGAGCGCGATGGAGCAACTACCGCTCTCCAGAGTAACCGTAAGTTCCCCTTAACTTCTTCACTCTCCATTCACGTACTCACGACTCCTGCTTCCCTT
TCACAGAATCCCAGATCGCCGCCTTCCACACGACAATCGCGCATCTCGAACAGTGTGTGAGTGGTCTCCAGCCCGCGCAAGATCGGCTCCGTATACTCGA
ACAGGAGAAGGCCCAACTGACCGCGGATCTGGCGGCCGCCCGAGCTTCTGTGCGTGATATGGCTGCGGAACGTGACCAGGCGCATGGCGAGCGAGACGCC
ATCCGAGACCGTGTCGCTGGTCTGGTTTCCTTCGTCCAGCCTGTCTCTTCCGCTGGTCCTCcgctgcgtgctgcttctggcaagcgccgccgaagccgat
CTCGGTCGGCATCTCCTGGCTCTTCGCGTTcgcatggccgacgccgagcttTGAGCTCGTCAGGGTCACCTGGATTGGGTCGACTCGGGAGTCTGCGTGA
CAGCGGTCAAGGCGATCGAGGTGAAGGCCATGGCGGTGACCGTTCCGACGATCAAGATGGCGACCAGAGTGGCAACCAGGGTGGTGACCATGATGACGGC
GACCAGAGTGACGATCAAGACGGCGATTCAGACGGCGATCAAGACAGCGATTCAGATTATGATCAGGAcagcgagctcgacgaagatCAAGACGGCGATC
TTGACGGCGATCGCGACGGCGATCCTGACAGCGATCAAGGCGGCGATTCACACGACTCCGATGAGAGCAGTGCTCACAGTGACGACAGTATCACCAGTGT
GCATCGCGCTCACCGGAACCGAATGATGCCAGACGCCCGATACCTGCAGCTCCCCCCGACCCTCGTACCTCGCCCGGATTGGATCCCTGGCTACCGGCAT
AGACTCGAGTTCCCGCAAGCCGCCATAGCTCCATGGCGTCCCCGTCGGATTCACAAGGTATCCGTAGTGGAGATGAACATCTCCGTTTTGTTCCATCACT
TCGCCCAGCCCAAGAACTGGCTCTTTCCTCTGAAGGAGCCAGGtgcttcgccttctccgtcgctcTGGTTCCCCCGTTTGCTCACCGAGACCAACACCAG
GGCGCTATATGCAACCAGCCCGTGGATCGTGCTTCGCACGTTGGTGACGCCGATCTCGTTTCCCATGAGTGGTTGGTTCGAGGTCTTGGTGCGACGGTAT
ATTCGGCTTGAAGACGAGCACCGGCAGGCGTTATGGGACGCTGCTCACGTACTCCCGATCAGCTCCGCTCTACGCAAAAAATACCCATTCCTGAAGGTGT
TCTGCGCGGAACGCAAGCAACGGCGATGTCGCTTGGGGGCGCGTTGGAAGACGTTCCTCAAAGCAGTCCTAAAAGGGATGATCCTGGGCCACTGCGATCT
GGACATACTCCTCAATCCGTTCTTCCTGCAGTACCCACGGCACAACGAGAAACGGTTGTGGTATCCGGGTCTTGGTCGCAATCCTCCTAGTGGAGGCTCT
CCACGCCGTCGACTTGGCTGAGCCGTGGCGCAACCAGTACCGCGCCAGCATTCAAGATCATCCCGGCTCCCAGATCGCTCGTTTGGCTGACAAATTCACT
TCCGCCGACGCCAATAGTAACGAAGAATAGGAGATCCGCGTCATGCAGCTAATATagcttcttcgtcgatcCGCTTCAGTCTTCAGCCAACCTCCTTTCT
CCTTTTCTTGATCGGGATAATTCGTAGCGTTCCCTCACTCACTCATTTAACATAAATTCACTTCCACCTTAGCGCGCAGCCATCCAGCACGCTCTTCATT
CCACTCCTCCCCGCGGCAGCCAACCTGCAACGGGTCTTGCGTCGCTTCCTCATGCGAATACATCACCCCGAATCGATTGCGAGTGGTCATTTCACGATCG
TACTCTCGTAGCAGTGCACTGCAGTTCAGATCGGCTTCGTCGACCCACGACGGGTCATCGTAGCCCCTCCAGTAGACCTTGAACTCGCGATGAACGCGAC
CGTAGCGTGTGCGTCGACCTTTCCGCATACCCTCGATCCGCTCAACCTCGTACTCGCCCTCGCTGAGACTGCGCTCCCAGCTGTCCTCTGGCAACGAAGC
TTCATCGAAATCGAAGCGATCCTCCTCATCGACTATCAGATCGATCTAGGGTCGATCAGGAAACGCCCGCACCAGCCTCAGCTTCGAGACATGTACGACG
GGGAATAAGCGATACTCCGTCCCAGCAGTCTCCAGGCGAGCTGCCTGACGATCCACCATCTCGATCACCCGAAATGGCCCGAGCCACATATGAGCTAGTT
TGCGCGCATAGCCCTCCTTCACGCGATCGAAGTACAGCCATACCTGCTCACCTGCTTGGATCAGGTGAGGCCGGATGTCTTCGTTATGGCGATCAGCCCG
ATCTTGAATCGCTTCACGCAGACGCTCGTTGACTTGTCCTCTCGCCCGTTGGTACTGTTGCTGCACGTGGTACCGCCATCGACGCGGCTCACTGTCTCGG
CGCCACGTGCAGCCCAGTGGTAGAGATGCCTCCAACGTTGATCGTGGGTCCCAACCGTGGATCAAGTAAACGGTGTGTCGCCTCGAACGCGATCTTGAGC
CGTGTTGATCGCGAACGTCAGGCGTACCGCGTACTCGTCCCAGTCTTGCTGATTCACGTCTGCGACGTACATCTTGAGCGCACGAGTCAGCGTCTGTACC
ATCCTTTCTGCCGTTCCGTTGGCTTGTGGGCGATAGGCCATCGTGGCCTTCTGTTTCTGTCCAACTATCCGGCGGAACGCACGAAAAAAATCGGACATAA
ACCCGGGATCTCAATCGTGGCGGATGGCCTCACTGGCTCCGATGCGTCCAAACACGCACACCTCGTAATTCTCCGCGATCGTCTGCGCTgtgcgcgacgc
gctcgcccTCGCGATCACAAAACCCGAAAACAAGCCGACCCAGATCAACAGCTCGGTGTTCCCTTTGAACGACTTCGGCAGCGAAGGGCATCCATCACCA
AGATCCGGAACGGGTAAGTGGCTCGCACATTCCCAAGTGACTCTCCTTGAACAAAGGAGCGCCCCTTACCAGTCTCACAGTCTGTACACTCTCCCACATA
GCGCTGGACACTTCGATACAAGCCTCGCCAGTGAAAGTGTGATCGGATGCGAAGATACGTCCACTTGATTCCTTGATGGCCTCCCTCCAGACTGGCATGA
TAGTGATGCAGGAAGTCCTGTTGCAGGGTCTCCGGTACTTCGAGCCGAGTGACTGCATCGCGATCCTCATCCTTAGACTTCGCGGCGgggcagaagaaga
gcaggcaatcttcgtccagctcgtagTCAGCTGCGATCTTGGAACAAGACCTGGCTTCTTCGGCggtcagctcctgcacgtcgcccttcAGATATGCCTT
CAGATCAGCGATCCACTtctcttcatcttgcgctTATCGTATCCGTTCACCTCTCATGCGTTGCACGATTGCTTCTTGTAGGACTTCCGGCTGTTGGGGT
CGTCGTCTCGCCGATCTCGTGACGGCGCTCACGCGGACGACCGTGTCGATCGCTTTCGGCTTCAGCAACTCGTCAAGTCGGTTGAGAGTGATCGAGTCTT
GGCGATCCTCCTCCGAGGTAACGactccaccttcttggctTTGTAACGCGGCACTCGCTAACCAATCGGCGCTTTGATTCCAGTCGCGCCTCATGTGCAA
GAGCTCGTGTTTCGGCCATGACCTCAATTTttccagcgtcttctgccgcaacaacagcaacccGGGCGCTTTGCAGTCGGTTTCGCTTCGCATCTGCCTG
ATCACCAAGTTGGAGTCTCCGCAGATGACCAGTCGCTCCCTGTCCAGATCGGACAGGAGATCGAAGCACAGCAACAATCCTTGATATTCGGCTTCATTAA
CCGTCAGGTCAGCCGCATACTCCGATGCCGCAGCGAGGATCATCCAGTCGGGAAGCTTCCATACGATCGCGCTGTAGGCTCCGGCCTTTTGCTTGACGCT
CGCAGATCCATCGAAGCTGACGACCAGCAGACTCTCATTCAGCTCAACTGTCGGCGGCAGTATGGTGACCACCTGACGTGGCTGTTTCCTCGGCGCAATT
GCGACTAACGTCTCATCGACTTCAGATCGAGGCGTGATGCTTGCCGCGGTCGTGCCAAGAATTTCGTCTTCTCCTTTCGCACACTTTCAGATCTCGAGCG
TCCATTCGGAAAGCAACGCAGCCCAGCGACCGAGTCTGCCGTCCAGTCCAGAGGAGTTCACCAGCCATGCCAGTGTCGAGTGACGAGTCAACATCTTGAT
CGATCGCGTTACCAGCAGCGTGTAGCAGACGTTCAAGACACGGAGGAGGGCCAACACTTCTTTGTCGACCATCCCGTAGTTGATCTCGTTCGCCTTCAAG
GTACGGCTAGTGAAAGTCACCAGCCAGTACACGCCTGcatcagcgccgcggcgATCGCCCATTTGCTGGCGTATACCACCATGACTGGAGTCCGATCCGG
GTCGAAGTGACGGAGAATCGGCGTAGAACCaatcttcgccttcagcagaGTGAACGCAATCGTGGCTCTCACCCAGCGATCGCCCTCTTCAGGAGATGAT
CCGGCGACCCCGGTCTCGTCTCTCTGTTCCCAGCCGCGCCGTCTGCTCGTCTACGGAATTCATGGAAATCCACCTCTCGCAGCTCGTACAAGATCACAGC
GTAGATCGCAAAATCTTCAATGAAGCGGCTGTAGTAGTTcaagctgcccaagaagGACTGCATCGATCGCAGCGTACGCGGGAACGGGAGATTGACCAGG
GAATCGAGATCCTTCGGATGGGCTTCCAGTCCACCTGCTGACACCTGATGACCCAGGTAATCGACCTTCCGGCGTCCCCAGACACTCTTGACGACACTGA
TCGAGAGATTCCACTGTTCGCAAGCCTCCAACAGACGATCGACCTTCGTGCAGAGGGTGTCCCAAGACTCGGTCTTGACCAAGATGCCGTCGATGTACGA
TCGTCGCCCCAGGACGGACGGCTTCTGATCGGTGTCAGGTTCGCCCTTCTCGAAGACGTCACTCGTCGTCATCAAGTCTAGATCCGCGCTGATCTTCAAG
TGTCTGTACAAATCATTGTCGATGAGACGTTGAGAGATCTGAGGCGCGTTCTTCAGTCCGAATGGCATACGCAGCCACTTGAACAGCCCGAATGGAGTGA
TGAACGTTGAGGTCAACCGTGCCATCTCGGTCATGGAGACCACCCAGAATCCGCTCGCCATGTCAAGGGAGCAGTACCGCAAGATCTTATCCAAGTCTTC
CAGGAGATTGTTGACCAACGGCATCGGATACACCATCAAGCGCGTCAGGCCGTTGACGACTCTGTAATCAATGCAGAGTCGTATATCAACACCATTCTTC
TTGATGATGATCACGATCGGGGATGCCCACGGCGAGGTCGAGTGCTTGATGATCCTAGCCGAAAGCAGACCCTTGATCAGCGCAGTCAACTTCTGTCGAA
ATAATTGTGGAGCAACTGGTCGCACACGCTGGGCTACTGGAGTGGAACCACCAACGTCGATGTTGCACACTGCACCGGATGCCGCAGGAAGCCGGGCGTC
CCCTTTGCCGGTCAGAAGATACCCTTAACCAGATGACACGCCGCAGCCATTCCATAACTTCCGGG