Description :
From Genome Similarity Track
Location :
contig_1:140483- 142455
Transcript NameFunction/comments
g38.t1hypothetical protein

Sequence
1972 bases(100 bases per row)
CGTCGGCTCACAGAGCCGACGCGTCTTCGTTACCTCGACGCCTAATGGCGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCAGTCGACACGACCGC
GTCACTCCGGACGCTTCGAGACCTTCTCGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCATATTTTCTTCCAACGACTCTCGCAGTCGTTGTTGTT
CCCTCGGGGTGATTCGAGACAGCCGCATTCCGCGCTGTCTTTGATGGAGGGACGCATGCATTACGTGGTGCATGTGCTGCTCCCGAAGTGCATGATCGTG
CGCTTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCCATACCATATCGAACTTCTTCTCTTGATATGAGAAGCGTACACGTACGA
TACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGTCAAGCCTTGGAAGACTCTG
CAGTCGAACAAAGTTGTTCGACGCACCACAGTCCACTAGAGCACGAAGAGACCTCTCTCTCTTCGAGCTTACCTTCAGGATGACAAGATTCGGCTTGTCA
TATTGCTTCTTGCAGTGATATTGACTCTCACTGGGGGCAGCGATCTTCAATACAGCGTGTCCAATGTCGACACGCTCGACCGCATCACCAGCAGGACGCC
CGGCGCCCTGCTGGTCCCTCTAGTGTTTTGTTAGCCTGTGACGATACCCAGTATCGCCACGCGGCTCCTGGTCGCGCGCACAGGTGCTGTGCCCTCGCGG
GCGTAGTGACCGATGTGTCCGCAGCGGAAACAATGAACATTGTTGATCCATGACGCTGCTGGGAACCAGCAGCCGTCGCACCCGAGAGGTTAATTGGTTC
CGGTCCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGCCGCGGGACGCTCACATGCAGCTTAGCCTTTCGCAGGCTAAACTCTTCTTGTATTGCGAGC
CCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGTCTTCATAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCTTTGTCGCCTC
GTCGATCGGGTTGGTCACGATGTTCGAGACCAAGTATCGTGCTCTTTGTCCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCTGCC
CTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTTGTTTGAGCTCCTCCTTGAACACCTCGTACGCGCTGAAGCACGTAGGGTCTGTGAGTCGGCGTT
CGTACGCCCAACTCCTTGCTCGTCCGTCAAGACATGACATGGCGAACGCAACCCTCGACAACAGGTCGACGATACGTCGAGCAGTAATGACAGTGTCGGC
CTCGACAAGCCAACGGAAGAGAGGTTCCCCCTCTCTTCCAACATAGCTGCTTACGTGGAGTGTCAATGACTCCACGCGCGGTGTGGCCGAAGGCGACACC
GAAGCTCGAGCAGTGGTTTCACGCTGCTCCTTCACGATGAAACCCAGAACAACATCGTGTTGCTCCGTCGGTGATAGCGTACACAACATCGTTGCTACCG
CTGCTTCTCCAATGACCGTCGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGATAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTTCAGACGTGTT
TGGGCTACCCACGAACATGTTACTGTCCGAGGGTGCGTTCTCAACCCCGCGTTCGTATTCCATACGAACGTGTTCTTAGTCGGTCGTTGGACGGGCTACA
AAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTTAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTATTTACCTTAGATCCA
GTCTACTTGTATCCACAAGTATACTTAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGA