Description :
From Genome Similarity Track
Location :
Scaffold_3:140480- 145179
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_3-snap-gene-1.30CDS Pa_3_10960
Pytap_DAOMBR444maker-pag1_scaffold_3-snap-gene-1.31Major Facilitator Superfamily (MFS)

Sequence
4699 bases(100 bases per row)
GACCAACGAAATAGAACTGTGGCTTGCGTGacACCAcTCCCCAcGTCTGCCTCGGTTACCAAGCCCACTGAAGCCCAACTCAaGAAAAAGCGCCACTCGT
TTCCCAATATCTTGCTGTCCTTGCAACTCGGACCCATTGGATCTGGccttACACGCATGGACAGCGCTGTTGGCTCCTCTAATCAAGCCCCGTTACTACA
ACTGCAGGGTAAACGCAGCAGCTCGGACCATCTTCTACAGGACCACAGCAGCCAAGAACAGAACGACTCGGATCTTTTCCAGGACGAAGTACTTCCAGAG
CGCCTCCGTCATTTGTTGTGGAAGTACAGTTGTCACCAAGTCGCCGAGCAGCTCTCCATCTTTCACCAGCAACAGCTCGCTACGTCGCTCGCACTCTGGG
ATTTTGTGGACGTACCGAGGCAACAGgCCAAACCTATCACCGACGCATTCAACCGGCTCGTGAGCTACTTTGTATGGTCAGTTTTGGTCGAAGAGACCGC
AAAAGACCGTGCCGAAGCCAttGAGAGCATCATCTCTATTGCCagTGTGGCCAGCGCTTCGCCACTCAACAATTTCCACCTCGTGATGGCCTGtGTGGGC
TGCCTTGGGGACACTCCGCTCATGTCGTCCCGCCTGCCGCTGACaTGGAAGCGTGTTCGAGCCAAGTTCAAGAAGCAACTCGTGTCGCTACGCTCTCTGT
GTGACCACAGTGGGGggTTCGAGTCGCTCCGCAAGCGCCAGACTCTTGAGAGTGCGCGTGGGTGCTGCATCCCATTCATTGGCGTCATTGGCgTGACACT
CGAACGCCTTCGACTCGTGCCGTATGCATCCGACGACACGGGGCTAGTGGACGTGGACAaGCTCGAGCGGCAGTTCGTGGCTGTAAGTGCGATCGAGAAT
GCCATACTGCGTCCATACCGATACGAAGCCATCTCAGGCGTCCAACATCTCATTCAACACAAGATGAACGTCCTGGACGCCATTGTGACCCCGCGACTCC
TGCAGTTGAGATCACAGCAGATTCTCGTGTGTGAGACCCAACAGCAAGGCGGCTCGAGGAGTTCGTCGCTCTACCGATCGCTTGGcGGGTCCCCAGGCGG
GGCGAGTGGCgcTGCAGATGCTGGACCGGACGCCGGGCCTCTtCTCATGCcgTTTTACGACATCTGCAACGTCCTCAGTACCGAGAAAGATCCAACTGAG
CGAGTCAAGATCTGTGTGGAAGCACTACTTGCGGACGACCGACAGCCCTGCAGCGCCCTCATGCGCACATTtCtCCAGGACTTTCGTCGATCCGTGACAC
ATGTGACGtGCCACGTGCTTCTCGCCAGTGTGCGCAACTGCATCGgCACGTTGAAACGCAATGTGATGGCTCAGAAGAGTTCCGAGATCATGCAGCTCAC
GGGAATGGACGATtCGTCgATTCAGTTGGAGCGAGACCTtTACGCAGCCTTGCTGGGCGCTGTCACGCATCCGATTGCGACGTGGCTTTTCACCAAAGTG
CGCCACACGTTTGCGACCGAAGACGCGCGGCTTCgACGAGACTTGGCTGAGTGGAAagCTCATCAGCCAGCCGACAGCTCTGACACCCACGCaCCTCTCG
TTGAATCCGATACGTCTCctCTGGGGCTTCTCCACACCGTCATAGCCACTGAGATCACCACACGTGAAgaCCGTGTCGCGAGCTTTCTACGGATGCTGGC
AGCATCTCCGTCGTCTGCGTTGTGTCGACATCCGTTCAGCACGCtCTTCATGCTACAGAACACCATCGAACCACtCTTTTTACCGCGTGAGCTACGCGAC
GCACTTGAGCTTCTGGAGGATGcaGTAGGTGCACTCAGCaCTCGGgTAgCGgaGCGTACGTCTCTGTCCAGTAGAGTGTtGCAGTcAAACGaCGCCGCGA
TGCCGGGGATAGAGGCTCATGACcGCCGTTGAAGTGGGAGTGTCGATTATtCTTTCtGCTGTATCCTAAGGGATTATACCGGAAGGTGTGAGTTGAGTAC
GACGCGTTGGCAAGTTGaTAAGCAAAGAAGCCTACGCGcGGTAGTTGAAGAACtCcGAGATCTACGAGGAATCACTGTGCAGAACACAACGAAGACCTTG
GCACTACCAGTGGTTTCTCCAACTCTAGACCAAGTCGAATGCGACTACGGCGGccctGGGGgATATGCTGATGTTATTCACATCCGATAGTGTGCTCAAC
AGGTGGCTCATCCTTGATGTTTtAGGaTTtcTTTcACTCGCAGGCGATCGCGCCGGCCTTcgTGGCCTTTGCCGTGTGAGAGTAGATTGTCAaGAGAAAA
aTGAGTAGCTTTTGAAATCAACATGATTCAAGACGAACAAGTAGAAGCAGAAGCAGAAGTAGAAGTAGACAATAAaCGAAAAAAAaaGAaGCAATCACCA
CGATAAGCGAAACCTAAAGCAAAAAAaagaacaaccataGCACCGAACAGAAACAGAAGAACACCCACAACAACAAATCAACGCAAGAACAAAAGCAGAC
GAGTAATCAAAGTAATCCAACAcTTGGATCGAGCCTCTCTGTCAGGTGAACGTGTCTACAATAAtGTAAAGCCCGCTCGTACCCATCACTTTGAATCGTT
GCATCGATGCtcGGGgCTCCGCTCTTCACTCAACAATGGAAACACGGCCACTAAAGCCTCAGCTGTCATCTCGAATCATCAAACACAAGGCCAGGGTTCC
ACTGATTAGTCTTCTGGTGGTACGGTTACGTACTtcATATGCCACCGATTGGTAGAGGTTGTCCACATCcCCAAGGACCCACTCTGCCTTCGCGCGTTTG
ATTGGCCATAATGTGAGCTTGTGGTAGCAGTCTAAGTtGCATTGTCaCTTCGGACGCATGCAACATCTCAGTTGTCTCCATGGAGCGCGtCTAACCTCCG
TCGGCCCTCCGTCCGCATTCGATCTCTCGCAGTCTCCCACCTACACGCAGATCGTCACGATCGCCTGAGCATGGAGCGTTCAAGCGCCGAAGCGAAGCTC
TCGACTATCGGCTCGACGGCGAAGTCCcGGCCCCCGacGAAGAGCTACAaGCTGCTCGACACCGCAACGCCAAGGGACTTCCATGCACCAGCAGACGCGC
TGCGTGATGAGCGTActGACATGGacGAGGAAATTGGTGTGGCTCATGACGACACGTTGACTCGATCTGGTGTCTCGACCGCCCAGTCGACTGAtGATGA
CAGTATGTCGCCTCGCATGGGCTCAGTTGCCACCTCCGTCCCTATGACCCAAGCTGCCCTTGTGGCATTGAGCGCCATCTCGGGCTTCCTCTTCGGCTAC
GATCTCTGCGTTATGGTGGTGGCTCTACCGCTCATCCACGAAGCGTTCcAGCTCTCGACAGAGATGGCCGAGGCCGTCGTCAGTATCCTCATGGTCGGCG
CTGTGTTTGGCTCATTGGCCGGAGGTGTGTTAGCTGATCGAATCGGCCGGAAGCCTGCCATCcTCGTGACTGGCATCTTCTTCCTCTTGGGCTCCCTGTG
TATGACGTTCGCCGACTCGATCCACGTTATGTTGCTTGGTCGCTTCCTTGCAGGCTTGGCAGTGGGTAGCAGCGGCCCCTGCGTCTCCACATATGTGGCT
GAGATCGCCGAGCCAGAGCACCGTGGAGCCCTCGTCACCATCAACGAAGTTATGGTATGCGTCGGATGCCTAGTGTCTGTGATCGTGAGCTCGCTGCTGC
GGACCAGCGTCGACGGATGGCGCAAAATGCTGGGGgTGACACTGCTGCCGCCTCTCGTTCAGCTAGCCGGTATGCCTTTCATGCCTGAGTCACCTCGGTG
GCTGATAACGGTACGGCCATTGAGTAAGGATTTTTTCTGATGTCAGAGCTAACGGTGGTCACGGCTTGATACATAGCAGAAGGACCGCTCCCACGAAGCG
CACGCAGTGCTCAGACGTCTCTTTCCGCAACGAGATCAGCACGAAACGGATGCACAGATCAAGACCCAGCTCGCTTCGAAGGAcTTCCTGACAaGGAGCT
TCACAGACGCCATTCGGCAAATCGCGACTGATGCTGTGTCAAGGAGGCGTGTAGTGCTTAGTCTGCTTGTAGCCTTtGCACACACGCTTACTGGCGCCAA
CGCGATGCTCTACTACTCGAGCTACATCATCGAcTCCTTGGgTGgCGCTCAAAGTACACACCGATTTTCTGgTGTAACCAAAgAAATGGgTGTCGCTATt
GCCAAGCTCGCTGGTGTCTGCACTGCCATCCTGGTCATCGaCAAGgTGGGgCGTCGTCCACTAGTCCTGTTTGGCTCGCTGGTGATGCTGCTTGCAGACG
CgaTCTTTGCAGTAtGTTTTTGGCAACTTGATGCCGCAGCTCCTGGTTCCGAATCGTACGAGACGACTGGCGTCTGgTCTCTCTACCTGTTCATTTATGC
CTGGAACTTCAGTTGGGCGCCTTTGATGTGGGTCATCTGTTCTGAAGTTCTaCCAGACGACCTGCGATCTGTGGGTATGGGGTTTAGCTTCGCTATTTAC
TGGCTCGGCAGCTCATTAGTGAATCAGACACTTCTCACGATCTTCGATgTGTGCGGTATGAACTGATGGCCTTCATGTTGTTATCACAGTGACTCACGAT
ATGCCGTTCCTGTAGGGATGTCCGCTAGCTTTCTGTTGTACGGCTCATTCACATCCGCTGCAATCGCATTCGTGTATTGGAAGGTTCCCGAGACAAACG