Description :
From Genome Similarity Track
Location :
contig_62:140468- 141837
Transcript NameFunction/comments
g9236.t1hypothetical protein

Sequence
1369 bases(100 bases per row)
GCAGGGGGTTACAGAAAGCGACCTGAGGGGGTAAACATCTTCTATAGAAAAACGCGTAAACATCAAATACAAGGCCACTTACCACCGTAAAAAAAGTGAT
TTTAGAGGGACTAAGTATGGAACAAACACAATCCAATGCCTTGGGCTATCCAGTTCGCGATACCAACATGAGATGGGCTCGCTGGAGCAGTCAACGAATG
CATGAGCTCCATCATGTATGTCGTGGCTCTGAGTGCCGCCACGTATTGAGAGACACCGACCGTGTTTCAGGTCCAAGCAAAGCACAACTGCAGTCCACTT
AGTTTCATAAAACGCAAGGGCTAACCTCACTCTGTGCAATCACTGATTGCCAGTGCCCGCTGACTAGGCGGGCATGTTTAAGCACGCGCTACTGTCAGCT
TTCCGCATGGATTACCACCCATGCTCGTGAATAATCCACCGTTCGGTTCTTGACACTTGCAACTTAGCTGACTCTTTCATTTGCAAACTTGATCTCCACT
CCTCCATTCGAAGGATGCTCCTCTACTTGCTGATGTCGTTGGTTATATCCTCCGTGCTTCCAAGTCTCAATGTCAGTGCAACACCTTATGCTGAAACAAG
CCTCGGTGATTTTTCCAGTTCGCATAAATTCTCATTTCGAGGTAAGGGCGATGAAGTCGAAGAGAGAACGGGACTCTCCGTTTCCGCTATCGAGAAGGCC
AAAACGTTATTCTCCTCGTCGACAACCACTACCGAAAAGCTCAGAAATGGTCAGCAACGGCAAAAATGCGGATACCGTTTTCTCGCGCATGAAGCTTAGC
ACCAAGTCCGGGGGTCTGCTGTTTTATGACCCGCAGTTCGCCGTGTGGATCAAGTACGTGGATGATTTGAGTGCCAAGTACCCAGCCAAAGCGACGTCGG
CGATCTCACGCTGACGACTCAATACGGCGACGATGATGCACTGTAAATTGCTTGAATCTGCGAAGTGGGTCCAAGACAAGAAACTCTCGCGACCAGGCTG
CAAGCCGAGCAGATGCAGCACTGGGCTACCGTCGGAAAATCCCCGACGACGTCTTTCGTCTGTTCGATCTCCAAGGCAGGAATTCCTTCTCACAAACCGA
AGTTTACCTCATGGACCACGTATGTGGACGACCTAACGCACTGAACCCGGAGAAGGCAGCATCGACGATCCCAACGTTGACGACTTACTACGTGATGATA
TCTGTTCAAGATGCTTGATGCCGCCAAGAAGTCGGACGAAACAAAGAGCATCGCCACCAAGTTGGAGGCCCAGCAGCTTCAGGGATGGCTGAAGAGTGGG
AAATCGCCGGACAGTGCTTTCGTTCAGATGGGACTTGGCAACGTAGAGGATAATCTGATGGCGAGTCCG