Description :
From Genome Similarity Track
Location :
contig_38:140451- 143251
Transcript NameFunction/comments
g7071.t1hypothetical protein

Sequence
2800 bases(100 bases per row)
GCTATTTTCTGGAAGATCTTTTGCTTGGCTCGCGTCATCGGATATTCCATCAAGTTCACGGCTCTCACCAGAACGACCGGTGAGAATGTATGAGCTGTAG
AACCCGGCCGCTATACGAACGACTTCATCGTTCGCGAGCGAATTAGAAGGTACGGGCAACGGGAGATCTGCAGAAGGAAGAGTTCTCGATCCTGCTCCAA
GTTGACCCTTGTTGTTACGCCCGAACACCATAACCCGTCCGTTTGACATTAGAATAAGCGTATGGTAGCACCCACATGACGCGACCTTGATTTTGGAGGA
CAAAGGTAGTGGTACATACTGTGCACTATTCTTGTGGTCCTTGCTTCCAATTCCCAACTGTCCATAGTCATTCCGCCCCCAAGTTATGAGCTTGCCTTTT
TCGCTGATCGTCACAGTGTGATAGTATCCACAGCTCACCGCAACGATCTTTTCATCGCTTTCTCCAAGTGATGTTTTAGCCAGAGTCGGTACCTTCATGT
TTCGTGCATGACCCAGGCCAAGCTGTCCGTAGTCATTCTTTCCGAATGAGTATACCTCACCACCACTAGTAATTGCGACGGTATGATATAGTCCACACGC
CACCTTGATGACCATTTGACTCGATAAGCCATCCACTAATTGCGGAGTGTGCTGGTGCTGGGTATGGTCAAGGCCCAATTGTCCACAGTCATTCATACCA
AACATCAGCAATTCACCGTTGCTCGATACAATTGCACTATGATGATAACTGACGGCGGCAGTCGTAATATGATACTTTTCACGGACACTGTCGATCATGC
GGGGCGTATGGCTCTTTGAAATTGTAGAGCCAAGGCCTAATTGGCCCCTGTCGTTGTATCCCCATGAATACACAGCACCGTCTGCAGCCACAGCTAGCAT
GTGCTCACATCCATTCGCTGCAGCGACCATATTAATAGCAATCCGCTTAGTGCACGAACAGGAGTAGCGATGATAACCCTCTCCTCAAATGTTCCATTGC
CGCATTGGCCACTCTTGTTAAGTCCACACGTGTAAACTGCACCATCCTTCATGACTACAGCGAGGACTTCATTTCCTCCAGCAACATCACGAACAGCCTT
TGCAGAAAAGAATGGTACATGCTCCAGCTTGCTCGTTGAGTTACAGTGTCCTAAGCAAAGTTCTCCGTAGTTGTTTTGCCCACATGCAAACAATTCACAG
TCATCAAAGCTGGCCACACCCGACAGTCTTTCCGACGTACCAGTTTGTCCTGATGCGGTTACTCCTATATTTTCATCTCCGAGCGCAGCGTTTGGCGATT
TGGATCGATTTAATACGTCACCGAGTGTTGCGATTTGTCATTCCACGACCTTCGTGGTGGGCAAAGAAGAGTGTTTTCCATCTGATCATCTTGAGATTCA
CCGGAAGTGTAGACGTAATAGGCTGAATCAAGATCCCCTCGGTTGTCGTCATAACATGCAGCGCACAGCTTGACACTGTCATCATCTCTCTGTCCATAGT
ATACCCCACACAGCGGCATTCTCTTACACTCCTCGCAACAATAGGACCCTGTCGTGCTTTCGTTGTATGCAGGGCCATTGTCGCGGTCAAAAATGCCGCA
TAATCCAATGAACCCGATGTCGATGTTTGAACCAGACGCCGGGCAAACTGCCTTTACGAGAACATATCGACCAGTGACAGGGTAGGCCAACTGTCTTGAA
ATCTGAGCACAATTACCATCTAGTACGAAGAACGCAACAGGCATACGTTCATCTCGGGGGCAATGTCCACTGCTTGGGGGAAAGGCAAGGCTGCAAAGTC
TTCAGCGGTCATGTCGTCAAACTCCTGATAGCAAGTTAGATCAGGAGGACTACTAGTCACAAATACTACAGCACAACGCAGAGGGCTAGAGTAACCAGGT
CCAGGCCCTCGAACACTGATGTAACTCACACACATAGGAGTGTCAACTTCATGCTTCAGCACCAGATTGACATTGGTTCCCTTCGCTGAGCTGTACACCG
TCGTATCGTCCAAAAGACAATTTCGAGAAGAATGAGAGCTACTGAACTCGCCACCGTCGCAGGAATGCACTTGTAGTTGCAAGCTCTTTCCTAGTTGCAG
CTCATTTGATGAAGAGATTTGCTGATTCTGGAATTTCGTGGCGGGGGAGGCGTGTGAAGGTAACTCAAGGCGGGGGCGGGGTGAAAATTAACATCAAAGA
CAGTGCCATTGCAGAGTGCTGATACCGCAGGGAACATGGGCTTGCTATGAGTAGCAAGGTTGAAGTGGCACACATCAGGTTCCGAGTGATCAGAGAAGAG
TGTGACGGTGGCTTTTTCGAAATCAAACAGAATGCCAAATATTCCGCCTTCTAACACGTCTTCTGGGCTATTCCATTTCACGTCAAGCTTGCTGTGCCTC
AGTGGCATATCCAACTCAGAAAAATCATTGCCAACAACCCCACAACTGAGGGCTGACCGTCCATCTCTTCCAGCCGAAACAACGCGAATTTCAATGAAAA
GACTCCCATTTTCGAAACCCTGGTTGGCCACAATTGTCTCGAATTGGTCCTCGGATGAGCTACAGTCACCGGCAACCACTGTGGATCCATTTTGCATGAG
TTGAAGCCGGTCACCTTTGAGCTTTCCGTTCCAACTGATTGTTGCCCCATCAAAAGGAATTGCGACGAGACCTCCGGAAACAACTGGGTTAGAAAACTGA
AAATTGGTGCTGGCGCACCACAGTTTTGACGGAACTGGGGGTGCAAGGTTCCAGTGTACGTCTGCATTCTTGACACCGATCGAAGAGAAATAACCGCAAC