Description :
From Genome Similarity Track
Location :
Scaffold_292:140411- 141513
Transcript NameFunction/comments
Aphin_H310_08609Peptidase

Sequence
1102 bases(100 bases per row)
GCTGCACACATGTGTGGCCATGATGGGCACATGACGTCGTTGGCTGGGTTTGCTTACCTGTTGCAGCATCGTCGCAACTACCTTCCTCCCAACACGTGCG
TCCGCCTTCTGTTCCAGCCCGCGGAGGAAGGCCACTTTGGTATGGACCCTTTTTGTCAGGATCAGCTTTCTGACCGCGACATGCCCTGGATTAGGCGCGG
TGGCCATGATCAAAGAGGGATGCCTCGACGGTGTTGATGAGGTGTATGGGTACCACAACGTGAATTTCCCCGAGAACGTTGTGGCCGTGAAGGCGGGCGC
CGTAATGTCCCACGGCCTCACGTTCCACATCACGCTCAAAGGACTGGGAGGCCACGGGTCAGCTCCTCATCAGACCAACGTACGAACTGCTCCAGCAATT
TCTGCCTCGTTTGTTGTGATTTTTTGCAATTTTCGCAGTCGATTGTCAGGCAGTTTTGATGGATGGGTAGTAGGACCCGATCGTCGCGGCTGGCCACGTT
ATTGTTGCCATACAGACGATCGCAAGTCGCAACATTTCAGCCCACGACAGCGCAATTGTGTCGATTGCGCAGGTTCACGGCGGCGAAGCCGACAACGTGA
TTCCGTCCTCGGTAGTCATGTCCGGCACGGCGCGGGATTTCTCCCCTGCTGTCGCTGACGTGATCAAAGCGCGCATGACTGCGATTGTGACTCACACGGC
GGCGGCGTACGGTGTGGAAGGCACGATTCGATTTGACGAGCGATACCCTGCCACCGTGAATGCAGCAGCTCAAGCGGAGATTGTGCGCGAAGTGGCGCTA
TCTGTGGTATGCCGTGTTTACTCGCATCATGTTGTCAACGACATTGTGGTGGCTAGGCTGGTGCAGCGAACGTCACCACATACGGGCTGCCCTTGTGTGC
GTCGGAGGACTTTTCGTTCTACCTCCAGCAACGCCCTGGTGCGTTCTTCTTCATCGGCACCGTCCAGAAACCCAGCGAAGACGGCACGACAGAACAGAAT
CGCACGTTGCATAGCAGCACGTTCGACTTCAACGACGCGATTTTGCCCTTGTCCGTGCGCATGTTCCTTGAACTCGCGCAGCACCGCCTCGCATGCGAGC
TG