Description :
From Genome Similarity Track
Location :
Scaffold_5:1404029- 1406140
Sequence
2111 bases(100 bases per row)
AGGCGTGAACCGCGTTGTTGAGCGCAAATTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTTCCGCGCACTCGATTGACACGCTTCGTCTGTC
CATCTGTCTGCGGATGGCCCGCCGTGGTCATCTGCAGACGGGTTTCGAGCAAAGGAAAGCGCGTATTACAGAGCGCAGCCGGTAGCCGCGGGTCCCGGCT
CGATCCAATCGCCTCCCGGAGACCGTAATAGCGGAACACGCCATCAACATACAGCCTCGCGGTCTGTTCGCCTATGACGATAGCGAGCACAGGATCAAGA
TGTACCATCTTGCTTAGCCGACACACCAACACCAAAATCCCGGTGTTGCCGTGTCCATCGGCGGGAAGATCCAAGATGAAGACAGGTCTCATCGACTTCC
AACAGTCCGCCAGTACAGGAAGAATATGTAGCGGAGCCGAGGCATGACCTGCGGGTTAAGCTTGTTGGCCTGTTTCGCATGTTTTCACGTACCGCGCGAC
CCAGTTGTACATGTGGGTCCACCTGAAGGCCTGCGAAACCGATAGGAAGGCCTTCTCGCGACCCAAGTAGCCGGTAGAGAGCGCTTGTGCGCCTTCGCGA
GGATGTCTAACGCAAGATCGTCGTCGTCGGGTACGACAACCCGTAGAGGCCCCATCCAGTATTAAAGGAATCATTCTTCAACTCATATAGGTGAAGCCGG
GAACGCTGTCGCGACTAAATCCAGTCGGACGTTGTGTTCGTTCCTGCTGCTAGAGACTTGACAACAGCCTTACTCCCCGATACGCCACGCATATATGATC
GTATAGATTCGCTTACCCACGTGTGACGGGGGCCAATTCGTAGTCGGGACGCTGAGAGAGGGCGTCCAGAAGCACATCGAGCTTACTCGGCTTGTGCTCA
ACGCGGAAGCTGTACTCCGCGAGAAAGAACAGCCACCTCATCATCCGTTGAGAGAAATGAGGCGAATTCGTCGCCATTCAAGGATGCGTGGTCTGTGTAG
ATCACAAAGGGCCTTGAGCCAGAAGATGAACCCGAAACCTCACTAATGCATACTTCATTGTCAGGAGCTCCTTGGCGTGGACAGGGCAGTTCCGTTCAGC
AACTTTGAGCTGCCTGGCCTGAAACGAGATGATTCGTTTGTGTCTAGCTATGCCGACCTGGCATCGCAGACGACGCTGACTCATCCGGCAGGGCCAGATT
AAGAGGCGCTTGAAGACTGGCGTTGATGGTAAATACATCATTCTGGTCCCGTCGGCATTCTTCGGAAGGATGCTTGACAAGGGCTTAGCAAGGTCCCCAT
ATCCTTTGCTGTACTGATAAAACGTTTTGGCCAAGACTACCACTTTCGACGATTTTTTTGCGACCAGGTGTCGGCCATGCTGGAATGGCTTTGTCCTTGT
CTGTGTCAGCTCGAACGCCGACTTTGATGACATTGCAGCCAAGAACCTCGATCTCTGGAGACGCGAAGACGCTCTTGTCGATGTTGACGTAGAGCTTGTT
CGCTCGCTTCACCTTCAACACTCGGCGGAGGTTCCCCAAATGCACCTCCACAGCCTTCTTGCCTCCCTCGGCACCGCAATGAACGTAGTTGTCGTCCAAG
TTTGTACGAAGGCGCGCAATGGCCTGAGCAGTTGCGTCACCAATGAGTTGAATGTCTGCCGGGGCGTTAAAAAGCCCTGCGGTATGACAAGCCACTCCTA
TAACATGTCGATTAGAGTGCTCACCGCGGTGAGCGGAATGTCGCTCTCGCGCATCAGGATTTAGTTGTACACCGTCTACCAAATCCAGCGCACAATACAG
TACGCTTCCGGCCATGCTGTTCAACAACACATCCTTTCGTAGGGTTGACGTATGTGCCGGCGCCGACGCGCGCTTCAGCCTGTTATGAGCGTGAGCTAGA
CGCCACTTTCCGGTTCGGCTTCCGAACGCAGAAAATTGGCGTCGAGTGCGGGAATTTTTACTTCCGCACCATGCCTGCGTTCGCTTTCGCAGCGATGTAG
GATCGATGATATCGCTCTGTTTGCGTGAAAGAGGCCATTGTTGCGTGACGTAGTATTTTGTGCGAGACACGAGATCGATCATTTGCTGTACGCCTCGATC
CGGTGGGAGTT