Description :
From Genome Similarity Track
Location :
Scaffold_743:1404- 4702
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_743-snap-gene-0.5Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_743-snap-gene-0.7Eukaryotic glutathione synthase

Sequence
3298 bases(100 bases per row)
GACCGGCCGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAACCAGCAATCAGCACCACCACCGCAACCAAG
TCGAGCAAGTGTACCCTGAACCATTGCCGGCACCTCTACCCGTGCGTCGTGTGGCCGGTCCTGCGTCCGGGCCCATCCCCATTGAGCTGCCTGACCAGCC
CGTGCGTCAGACCATGCTACCGTCGGCGGCGTCGTCGACCGAGGACGAGCCGGCCAATATCGACGACGTGCTGCTGGGCAAGCGATGGTCAGTCCACGTG
ATCTCACATCTGTACCAGTTTCAGCGCCAGGAGCTCAGCGACTATGCGAACGAGCTTGTCAAGTACTTGCGTGGGCACGCCGTTATGACGTTCGAGCAGG
AGTTTGGGTACAGCGTCGTGATCCGATTTACGTCCGAGTGCGTCGCGTTCCATGTCGTCGAGGCGCGCGATATTCACGCGGAATTCCTCATGGAGAAAGC
GGAACCGCCGCCGCCGCCATCCAGAGAGATGGGAAAGCAGGAATCAGCGGAACCCGACGAGCTCCGCCAGCGCTCGGGAAGCTTTGTTGTGTACTTTCCC
AAGTCGGCCGAAGATGCGAGCTCCATGGGCATGCGGACGGGTCCGCAGGCGGGCACTAGTAATGGACCTCGACGTGGCCGCCTGCACTCGGGTGGCTCGC
GAGTCAGCAACGACAATGGCAGCGACGGCAATGGTGGATCGGCCACTGCACGAGTGGATCCAAAGTACGTGTTCTTATTGCGGGGGAATGAGGAGCTCAT
GGCCTGGGTTGGCTCTTGGCTGCAGCGCCGCTTCCAGTGTGTCATCGGCATCCACGTCGTGCGTGTGACGGAGGAAAATCTGCGACGTGTGACCCGCAAT
TGGGCCATTGAGGCACTCGAGCGCGAAGAAAAAGTGGAAAAGGCCCGGCAGCGCCAGGCCGAACGGCTCCGCAAGGCCAGTGCCGTCAGTAGTCGGGGCG
AAGAACTCAAGAGCAGCGCCGGCCCCACACAGGCAGCGACGGCAACGCGGCCCACGCGTGCACCGCTGCTGCTAAAGTACCGTGCCAAGGCCGAGAGCGA
TGTTGTGAAGGCGTTCACGATGACCATGCCGTGGGCAAGCGTGCGTCGCGTTCATGCACTCATGGACGGCGGCGTCGGGAGTGCACTCGGGACCGTGCCC
GAGGTCATTGAGCGGCTCGAGCACTTGTACTTTGGGAACCTCCAGAAAGACGTTGCGAGCATGACGCTTGTGAGCGTGCAGATGGAAGAAGTGGAAGTGG
ACACGACGGGCAAAGTCAAGGTATGATACCGGCATGCACCGATGATTTGGATCTTCTGGGAAACTGACCGAGAGATATCTCGTCTTATTCTGCGCTTGTA
GTTTTTCAAGTCGACAATGGTGCAGTCGATCCTGCAGAGCTTTCTGGACATTTTTGTGGTCCAGCAAGTCACCGGTCCGACAGAGCCCATGACGACGCTC
TGAGGAGATCCAGTCCATGAGATATTTGCCCCCCCCCCAGTGTGATGATGGAGGAACTAGAGAGCCATAAATAAAGTTTGTAAATACATATCTCAAATAT
CACGAAATCGGAGATACCGGTATTTGTACCGGTATACCCCCAAGAGGTCCACATTGCCCCCCTTTCCAAACGGCAACCATCTCTGCGGCTCACCTCGCGC
AAAGCGTTCGCCGTTCCTCCAGCCGCAGTAGCCACCATGGCGCCCAATTTCAAGATGATGGGGCTGAGCTTCGCCCTGGTCATTGGCAGCAACGCCTACC
TCGACCGCGAGAACGAGAGTGCGTCCTTTCTTGTGACTCATGGGCGATCGCTGGTTGCTGATCAAATGAGCTCTTGCGTATCTTCTCTCAGTGCACGTGC
AGATCGTGCGCGCGCTGTACGGGATCTCGCAGCTCGCGTGCTACGCCATGATGGCGTACCTGTACTTCAAGGCCAAGGTACGCAAGCCCCAATGAATTGC
CCCACGTGTCATCTAGAATGAACCACTCATATTGTCTCTGCGTTCGGGTAGAATAACACGGAACCCGGCGTCGTGACGGTCAAGGAAGACGTTGGCTTTG
GTCAAGAGGGCGAAGCCGACGAAAAAGTCACGATCTCGGAGCACGACATGCGCGTATGCTGGAAGGATATTCAGCGAGTACGTTTCGGTCTCTCTCTCTC
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTGTCGTGTCG
GTCTTTATCCACTACAAGTGGGGCTACTTCCCGCCGCTCGTGATCCAGACCATCACGCAGCCCTTCAACGTGTACCAGACCCAGCTCTTCCGCATCTACG
TGCGCGCCGAGCGTGCGTGGGGCGAGCTGCGCCGCCCGTGGCAGGACCCGACGTCCATGGGCTCGCAGTGGAGCGCGTGGAACGACACGGTCACGTCAGC
GCTTACGGGTGAGCGACCGGCTCCACGCCAGGGCAAGAAGGCCGCCAAGAGAGCCGCCAAGAAGGGCAAATAGAATGGCCTCTCGTCCAGTCAGTCTGTC
GATAGAGCACGAGAGCCATGCCATGCGAATAGGAGAAGCGGGTCAAGTGCACCCCCGGTGTGCGATCTCCTTTTCCTTATCCACTATGAAGTTTATAAAC
TATGGGCTCCTGATGGTGTGGCGAAGAGTGCTGGCGAGTTAGTTCTACACGAGCAGCGGGCTGCTGACCACGGAGAAGCCCGTGGCCACGCCGCCTTCGT
TTGTGCCCGAGAGTTTCGTGCGCAGCAAGTGGCCCGCGTGCTTGTTGAGGATCTCGCGGCCGTCGTCAAAGAGCGTCGTGATGTACATGCCGAGTTCGCT
GATGGTCGGACCGCTCGCGGTGAGACCATTGCGCACGAGGACCTACCGTAAATCACACTCAAGATGTTAGAGATCCCACCCGTCGTCAACGAAGAGGTGC
ACCACAAACGGAGACGTACGGCGGCATTTTCCTTGGGGAAGATGCGCTCCATGAGAATGTACGACTCGAGCTCCTCGGGCGACATCGTCTTCATGGCTTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGTAGAGATTGTTGCCGCCTCCTTCTCGCTGTGGCTTGAGCACGCGCGCACGGGCATTATCAATGGCCA
TTTGCTTGACGGACGCCGTCTTGTCCGAGTCTTTCTCGAGCCCCCAGAGACCGGCAAACGACGTCTCGAGCAGCGCGGCCTCGTCGTCACTCACAAAG