Description :
From Genome Similarity Track
Location :
Scaffold_1455:1404- 3709
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1455-snap-gene-0.4Zinc finger, DHHC domain containing 16
Pytiw_DAOMBR242034maker-piw_contig_1455-fgenesh-gene-0.1GJ16446

Sequence
2305 bases(100 bases per row)
ACGGATCCTGGATACGTTGGCGCGAATGATACGACGGGTACCGACAGCAGCAGCGACGGTGGCGACTGCGAGGCTGCGAGTGGCTTTTGCAAGAAGTGCG
CTGCCGTGAAGCCGCGGCGAGCGCACCACTGCCGCGAGTGCGGCAAGTGCGTCCACGGGATGGACCACCACTGCCCGTGGATCAACAACTGCGTCGGCTA
CAATAACCAGCGTGCGTGCAAGTGCATCACTTCGTCGTATCTCTCTCTCTTTGTAATTGACTTATTTCCGTCTTTGTATGCGCAGGCTTCTTCTGGCTGC
TGCTGTTCTACCTCTGGGTCTGCTGCGCCTACGTCGCGAGCCTCTCCTACAACCCATTTGTCAAGGTGCTGCGAGCCAGAAAGCACCGATCAGCGCAGCC
GTTGGCGCTCGAAGACCGCGCGCGCAACGTGTTGCTTTTGTTCTCGTTCCTGCTGACGGGCACGCTGGGCATCGTGCTCTTCGGCTACTGGCTGTGGCAC
TCGTACCTGGCGCTGACGCAGCAGACGACCATCGAGTTTGCCGGTCGATTGAGGGATCAGGAGAGCGGCCAAGGATCTCAAGCGCTACCAATCGGTGATC
ATCAACGCAGCAAGATGCATCTGCGCAATCTGCAGCGCATGCTGAGGAGAACCGACAGCTTGTGGCTCATTGCACTCGTTCTGCCATCAACTGGGACTGC
GCATCGTGAGGATACACATCGATGGAGCGTCTGAAGGTGATGCTGAGAACACACACGCGAGAACACGGATTACAGATCATGAAGCCAGGATACATATCAT
GCCCTCTCAAAGGACGCTTGATACATGATACGCTCAGGTACAGTACTGCGCCGCATGATGTGGATTCTCCATGTCTTCTCCCAGAAAGCGAGCGACACGG
AGCCACCGAGGAGCTCGATTTATGGTATGAGCGCTCTGGTGGATATCAACTGGCCGTGCATGTGACTGCACTGGAAGAAGCCGTTGCTGCTGCATGTCCG
ACCCAAAACAGGAATGCGCGCAATTCGAGTCGTCGAATTCCATGTGATCTTTGCTTTGGATCTTGGTCGCCCATCTCACCCAAGCCGCAATGCTACTCTC
TCTGTTGAACTTTGCTGAGAAGAAAGATACGAGCACCAGTTCTCCTGACAATACACGGATATAGCAGCAGCATGTACATACTTCATATGAGTTCTGCTAC
AAGAGCCCGCCACATGCGAATGAATGCGCTCGTCAATTGTCCATGAGAAGTCGCCGTGTGCGTCACCAAGCAATGTGGCGGCTTCCTCAGATTCCGAAAC
GTTCTTTTGGAAAATTCTGATACTACGGTCCGCTTTTTGGAGATGTGGGTACAGAATGCAGCCATTGAAGTGTGACACCAGCATAACGAAGCCAAGATGT
CACTGGCGAGGGGGAAACACGTCTTTGGGTAACGTAGCGTTTGGTAGCAGCAGCCTCAATGTCACGCATGCATTGCGCTGTCCGAGCTGGTCTGGTGAGC
ATCCCCGCAAGCGCCATGCTTGCATCCCAACACTGTAGCTCAAGTCATGTTGCTTTGTCCAGAGTCAAGAGAGGTGGACACAACTTATAAAGGAGTGTGC
GACATGAACCCACCACCGAAGAGCTCATGGCTCAACCAGCAGCATAACTTACTTAATCGAAGAGCGAGCGAGCCACCATCTCCACCCACTGGGCTCGTTC
CATTTGGCCGCTTCCTTCGATCACGAGGAGGACGAAGGAGAAAAGGAACAACAGTGCGAGCGAGCGAGCGTCTGTCCGTCCACTCGCGAGCGCTCACTCG
TGAACGCGCGCTCTATAGCAAACAGACGCGCAGATCCAGCTCGCCGTACGTACGTAACTCGCAAGGGGCACTCGCAGCTCTCGACGACGCCGACGACAGC
GCAGCCAGTTCCAAACGTGCAGGCCGCGCAGCAAGAGTCACAATGTCCGCGGACCACGCGCCGACGCCCAAGCGCTCGACCGAGCGGCGGCTGCGCAAGA
TGAGTCAGGAGTTCCCGCCCACCGCCTTCTCATTCCACGTGCAGGCGCGCGTGCTCTGCGTGGGGCTGGCGGTCGTCTACCGCGTCGCGATCACGATCAC
CACGACCACCACGTGCGTGTCGTGCCAGTCGTGGGTCATCGCCATGAGCCACGCCAAGTTCCGCACGTTCTACGCCCAGGTGCGCGCGATCCTGCAGCAG
CACGAGCAGCAGCAGCCGAGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNN