Description :
From Genome Similarity Track
Location :
Scaffold_38:1403734- 1406633
Transcript NameFunction/comments
Phyin_T30-4PITG_15161Putative uncharacterized protein

Sequence
2899 bases(100 bases per row)
CTAGTATCGCACGTTCGAAGCGAGCACCCAACCCATGAGAGCCTCATGCTCGCCGCTAGCTCGGCCGAGACGGGGTCTATCCTCAACTACGTGCGGCGCT
CCTCTCTCAATCTATTCAGCTGGATGGAGTGGATCCTAAAGAGCAATCTTCCGCTGTCATTCTGCGAGAATGAGGCGGCCAAAAGGTAAGTCATACGCAT
TTCTAAAGTTGCCTATGAATTTCTAACTTCTGTTTCTATTTGCTTTCTATAGGTACTAACCTTGACTCAATTTGTGTCGAGACGCTCGTCTCTGGCATGA
GTAGTGTGACGCGGGCCGTGGAGCGTGGCATCGCTGAAGAGATTCCTGACCTTTTTGGGCTAATCTTTGATGTGTGGTCTCATGCTTCAGAGCATTACAT
TGCAGTGTACGCTCGCTACGAGGTGGACGGGGTCGTCAAGACTCCTCTTCTTTGTATGGCTCCACTGCTCAACGAGGAGGAGGAAGACCTCTCCGCCCGC
GGCCACATGGCGTTTCTTGCCACTATGCTGCCTCGGGACTACGGCAAGCAGCTGGACCAGTGCTGTTTCCTGGTGGGAGACAACTGCTCGGTTAACCGGC
GGCTCGCAACGCTGATGGGTGTGCCGCTAATCGGCTGTGCCGCCACCGCCTTGACCGAGCAGTGCAAGCTGACATGCAAGACTATGAGGACGAGCTGGAT
GCTGTCCAGAAGTTAATGATCAAGCTTCGTAACCTGAAGCAAAGTGCCAAGCTGAGGTAAGTTTGAACTGATAATGATGTAGTTAGAAACGTTTCTAATT
GGGTTTCTATTTTGAATGTAGAACTAAAACGCCGCTCCGTCCAGTTATCCGCCAAGATACTCGATGGAGCTCCACTTTCGCTATGGTGATGCGGTACTTC
ACACTGCTGGAGTTTATCGACAGCAATGACGACGACATCGCAGATTTGCTGCCGTCCCCTTCGTACAACCGCCGTTTGCGTGCTCTGCTAGCAGACTTGA
AGAAGGTCGAGTCCGTTGCAAAAGCTTTACAGGGAAGCGAAGTATCACTACTTGATGCTCGAGTGTGGCTGGATGGCTTGATTTCCATCAAACCACACTA
CGCTCGGTACATTGGTACGTGCAGCATATTTTTTCCTTTTCTAGTATCCATTGCTAATTTGTTTTGTATTCACTATGAACACTAGGCCCACGCGCTGAAA
TTGTTCACAGCCCTGACTTTGAGCCAGGGTGTGTACGGTCTTAGGCGGCAATGCAGCCCGCCTCACGCGAGCTGAAAAAACAGTGTTGACTCCGTTCAAG
TCGACAGGCCCTCCTGCAGTGAGTGAAGACGAGGACGACGGCAAAAGTTCGTTCGTCCAGCTGCTTCAAAAGAGACGCCGACTTGCCGCGAAGAAAACCA
AGTACAAGCTCTTGCATGCAATCCCTGCGACGTCCAACGTGGTGGAGCGCTTTTTTAGCGTTGCTCGTACCACGTTTGGCCAAGAACGCCATGGACTGCA
GCCCATTACTTTAGAAATGATTCTCTTCCTGCGCGAAAATGCTGGTTACTGGGACGCACAAACACTTGACACAGCAACTCGAGTGTAGATACCTGTTATT
GATTCAATAAACCGTGATTATTGCAGCAATAACTCAATTATTTATTGGTCTTCTAGCTAAAGCATCATAACGTATTGCCAACATACAAGCTAGCTTCGCG
ATAATTTATCGTGAAGATGCTACTACGATAAATAACAATATCATTTTCGGACCCCCTGAGCACCAGGTAGCCGTACATCTCGTCATTGGCGTCTTTCTGC
ACCCCCATGGCTTCTAGAAAGCAGACATCCCGCGGCTCGATAAATGGAGCGGACGAGCTGTAGAGCCACTTGAGGCCGAAGAAATGCAGCGGGTCGTCCG
CGGTTGCCAACTCGAAAACGCGCAGAACCGCGAAATCCGTGTCGACATCCAGGAAGGACGTCGTGGTGCGCATCTCCTCGTAGTTCGTGTCGGCTAACCC
GTAGAGCAGATTCTCTACCGTGCCGGCAATATTTCCCGTCGCTACGATACTTGGCTGGCCGTTCGCTACCGCTTGTCTGGCCTCGGGGATGTCCTCGTGC
TTTGCGATTTCCTCAAGTGACCGTCCTCGCCGTCTACGTCTGTAGATTTTTATATCCTCGAGCGACCGCACGTACTTCCAGTCTGCGGGTGGCAGGCACG
GCAATTTATTGGCTTTGCGCTCATTGTAGTGCTGCTCGTCGTCCAGCAGCTCGTTGAGTCTGCGCTGCACCACATCGCGATACTCAAGCTTCTGCGCAGC
CGTGACCTCGATGTGACCGAAGTAGTTTTTTGGCAGCGGGAAACGCAGCTTGGACGACATTGGAAGTAAGTTGCCAAGTGATCAGCAAAAAGATCCAGCC
ATGCCGGCGCGAAAGACTTGAGCCCAATGCATGTCTTTCCTCACGACGAGAGCACGCTACGTCAGACGAGAGCCACACGTTGGCAGTGGAGACCTCTTAA
CAAGAACCCCATGATCTGACGTAGCGGTGTCAGCAACGCGACGGCTATGGACATCACTTGACAGCCTGTCAAGCCTACCGGCACAGGGTCAAGCTGAAAA
TGTATTCAGAAACACCGCCCGTGGCCAAGACCCAAGCAGCCCACATTGAAGATGACGGCCAGGTTGCGCTTCAAGAGGTGATCAGGACGAATGGCGACAG
TCATTAATGCTTGGATGAGGAACGCGACCGCGAGGCGGGACGGGCAGTTCGACGGCAGCATGGATCAAATCAAAACGACCCGCTGTTCGCGAGCATGAAG
ATCAAGGCGTCACACAGTGATGGTGTTACTATACACTACACTGTCAGGGGGTCCGAAAATGATATTGTTATTTATCGTAGTAGCATCTTCACGATAAAT