Description :
From Genome Similarity Track
Location :
Scaffold_52:14036- 15348
Transcript NameFunction/comments
Pytar_ATCC12531snap_masked-par_contig_52-abinit-gene-0.19Cyclic nucleotide-binding domain containing protein

Sequence
1312 bases(100 bases per row)
GCATACGAGCTCACGCTTGTACTGGGACCACCGCACGTCTCGCTCGAGATCTCTGCGGACGTTGTCCACGTTGATGCGGTGCGCGAGTTCCAGACACTCA
CTTCGCATGGCCGCTTCAGTCGCTGCATCTTTAAGCACAGTCTGGCGAAAATCGACGCGGTCCATACGATACAGCACGGCGCTTGGTGACGAGACCAGCA
CGGAGAACTGGGCGTCCATGGCCCCAGTGATGACTTCAAATGCCCCGAAGAAATGGCGGCTACAACGTCGTTTCGTTTCAATAATAGCAGTTTGAATGGT
GTGGTGTGTCGACAGACGAACCTGTTAATCGAGCCGAGTTCGACAAAGCAACGCTGCCGATCGATCCTGAGCATGGGGAACTGCTTCACGAGGCGGCACT
CGCCGTGCTTGACAAAGTAAAAGTGGTCTACAGCGACACACTTCGCCCCTAAGACATACCCCAGACGCAAAAGACGAATAGGAGACACTTACTGGCGGGC
TCGCCTTCCTTGATGACTACGTCGTTGTACGAGTGGCTCACTCTTTCCATGCGGCCCGTGAGTCGGAGAATATTGTCGGCATCCCAATGCTCCAACGCTG
GGATGCTTGTGAGGAACTTTATCTTCTCCCTGTGCAGCAAGCACTCGCTTAAATATGAGGACACTCATCCAAATAGACACTAGGCATTCGCACCGAAGCT
CCCGGTCTGCATAACTCTTGCGCAGCTCCAAAAACGCCTCCCGCTCGATCTTCATGCACAGCGCCTTCTCATGAGCGACCACAGACGCTGTACGCAGCTG
GTCGCTCGTCAGTAGGCCGACATCGCCAAAGCACTCGAGTGCCTTCATGAACCGCACAACGTAGGTCATGTTTTGAGCCATATCTACGGGGTGCAAGAGA
GCGGCTCAGTACTAGTATTTGAAAGCAATGGGAAAACTCAATATCCTCACCAGCGACGCCTCCCGGGTTCAGAAACGTCGACTGGATGCGTGCGCGGTTA
AGAATTTCATCGAAGCCGTTCATGGAGGGCACGGCCGCGTGTGCAAAGTCGACGACGACGTTCAGCGAGCCGTACATGATGCAGTAGAACGCGTCGGCCG
GGTCGCCGATGTGGAACAGCTCCTCACCACGCTCCAGCTCGACGCCCTTGACGATTCGCAAGTACCGCAGCCGTTCGCGTGGTGGCAGATCGGCAAAGTA
CGTGACCGTGTGCACTATGACTCAGCTGGAGAGGTCAGTCCACAGCTGCAGGCTCACCAGCGAGCGACGTACCGTATCGATCGAGAAACTCGTAATCATC
TTTGCACCGCGC