Description :
From Genome Similarity Track
Location :
Scaffold_31:140358- 141512
Transcript NameFunction/comments
g8044.t1hypothetical protein

Sequence
1154 bases(100 bases per row)
AGCACCACGAATGGCACGTACGCGTAGTCCTCGAGCGCGTCCGAGATGTAGGGATAGGCCACGCCCACGACCAGGTTGCACAGCCAGTTGACGCCGATGC
AGAGCGACGAGGCACTCGCGCGGATCGAGTCGGGGAACATGTCGGCCGTCATGACCCACACCAGCGGCCCCAGCGTCACGCCGAACGCGATGACGTACAG
CGCAGTGAAGACGACCGACAGCGCCGGCAGATCCGCGATGAAGGACGCCGTCATGCCCACGGCCATCACGACCGTGCCCGCTAGTCCCCAGAGGATCATG
CTGCGCGCTCCGAAGCGGTTGGCCAGCACGCCCGTGAAGAAGGCCGGCCAGATATTGATGAAGTTGATGATGAGCGTGCCGACGCGCGAGTCCGAGATGC
CGGCGTCCGAGAAGATGCTGCCCGAGTAGTAGAACACGGCGTTGATGCCCGACAACTGCTGTGCACAGGAGAGCAGCACTCCTCCGAGCAGCTGCATGCG
GTAGCGTGGGGCGAACATGGATTCCGTCGAGGTGGAGTCGTCGTCAGCGTGCGGTTTGCTCACTTCCAGCCACGACATGGCCGTGCTCACATGCTCTTCG
CCGTACAAACTAGCGATCACCTCTCTCGCCTCCTGCGCTCGCCCTTTCGTGAGCAGCCACGCCGGACTCTCGATTGACAGTGTCGGCGCTAGAACCAGGT
ACAGCACGGCCAAGACGCACGGGAAGGCGGCAAGGTATCGCCAGCCACTGCTCGTGTTGGCGAAGAAGAAGCAGATCGCAGGAACTAGAATCCCGAGCGT
CGTGAAGATCTGGAGACCCAGACCCAACGTGTTGCGCATGGGCGGAGGAGACAACTCGTTCACGTAGGCCCCGATGGTCCCCGTAGCGGTTCCAGACGCC
AAGCCGGAGATCAACCGACCGACGGCGAACGCCCAGATGTTGGACACCGAGGCCTGCACGACCCCACCGAGGAGCATGAAGGCGCAGTTGCCCATGAGAG
CCTTCTTCCGGCCGTACTTGTCACTGAAGTGGCCGCAGCACAGAGAGCCGAGCATGGCGCCGAAGATCCAGGCGTTCACGGCGAACGTCCACTCGAGCTT
AGAATGGCCGGGGAACATGAGGCACGTGTCTTCCACCACGGGTCGAGCATTGCA