Description :
From Genome Similarity Track
Location :
scaffold_1626:1403- 2896
Transcript NameFunction/comments
g11585.t1hypothetical protein

Sequence
1493 bases(100 bases per row)
CAGGGCATCTGCTGTCTTGCCCTTCGCCATCGACTCCATGTACTTGCCCAGAGTCACGAACGTCAGCAGCATCGCCGACGACTCGAAGAAGTGGTGGCCC
TCGTAGTTCTCGTGCAGCGCAGAGCCAATCAACGACACAAAGCTGTACGTGTACGACATGGTCGTGCCTGCCACCACCAGGAAGTCCATTCCCATGGCGC
CGTGCTGCAACCCCTTCCACGCAGCCACGTAGAAGCGACGTCCAACACCAAACTGAACGGGAGTCGCCAGCAGAAACAGCAGCAGCAGCTTCACGGTGAC
AGCGTTGAACACTGGAGTCATGAGCAACATCTCGACCGGAGGAATGTACATGAGCACCATGTGGATGAGCATGGCCGGCAGCGAGAAGAGCATGGCCGTC
GTCAGCAGCTTCCGCCACTTCTCCACCTCCGACTTGCTCAGCGCGTGCTGGTCCGTCGTCTCCTGCGCCACTTCGGCCGAGTAGCCCAGGCCGTTGATGC
ACTCGAGGAGATCGCGAGGCCCCGTCTTGGACAGCTGCTTCAGGTGCACGTGCGCCTTGTTCAGCGGCAGATTCACCAGCACCTTCGTCACTCCAGGCAA
CGCGCCCACCGCCGACTCGATCTTCCCCACACAGGCGGCGCAGCTCATGCCCGTGACGGTGAACTTGAGCTCCAGCGAGTCGTCGTCGCCCGGTTCCACC
ACGTGCGAGAACGTCGCCTTGTAGCCTGCGTCCTGGATCATCTTCTGGAGCTCCTGCCGCCCGTTCTGGATCAGGTCGCGGTCGAACGAGACCTCGGCCT
TCTGGCTGATGAGCCCCACGCGGCAGTGCAGTACGCCCTCCGCCTTGCCCACGTAGTCCTCGATGGCCTTCACACAGGCGGCACAGCTCATCCCTTCCAC
GTGGAACACGGCACGCGGGTGTCCTGCTGCGTCAGGTACATCCAGCGCCACATCCTCCTCCTTCTCCTTCTCCTGCTGCTTCTGCTTCTGCGCCTGCAAC
TTGATCGCTGCAGCCTTGACGGCGTCGTACGCGCTGGCCTCGAAGCCCACGCACTCCACCATGTCCACCAGCTGCTCCAGCGTTGCACTGCCAGGGTGCA
GCAGCGTCACAGTGGCTTTCCGTTGCTCGAAGCTCACGACCGCCGAGGCCACGCCGTCCACGCCCTTGAGCGCGTTCTCGACGGTCGAGCCGCAGTTCTT
CTGGCACATCATTCCCTCCACCACCAGCTCAATCGTCTGGCTCTGCGTCTGCGTCTGCGTCTGCGTCTGCTGGGCCGGAGCTTTCACGGCGGCGCCAAAG
CCCACGCACTCGACGGCGTCCACCAGGTCGTCGGCCGTCACGCAGGCGCCAGGGACGCACTCGACGCGTGCGCTGCGTCCCTCGAAGTCGACGGCGGCGC
TGCTCACGCCCTCCACGCTGCGCAGTGCGCTCTGCACCGTGTTGCCGCAGTTCTTCATGCACATCATGCCTTCCACCGCGAGCTCCACGACCA