Description :
From Genome Similarity Track
Location :
Scaffold_134:140228- 141763
Sequence
1535 bases(100 bases per row)
AAACTAATAAGTATATATTTAATAAAATACGATGTTCAACTACATTCTGAGAAATGGGAAAAGTGTAATAAAGCAAAACTAAAGATCGATGCTGTACACA
TCCAAATTTCAAAGTTCCCTGAAGCTGTATCGGATGTTGATAAAGCTGAGGCGATATTGAGTAAAATATTCAAGTCTCGCCTTCACATAGATGTTGAATG
TCCTTGTGGTAAAAGATGAAGCGATGCAACTTTGCCCACCACTGCAGCTTCCCAGAACACAAAGTATGGATTTTATCTATGCCTGAGTCCACCAACGGAC
ATTCTTGGTGATCGAAGACCTTGGAAGAATTGAATCCAGATTTCAAGTATTAAAATAAAGTAAACTTAATTTGTTTTGATCCTGATAATTATAAAGCTAG
TAACATAAAGTCAATTTTGATATAAGGTTTAATAAATATAAAGCCATAATGACATACACGCCTGAACAGTATCAGCTACACAACGAGCGTACCAGAGCCG
CTCAGTAGCGCTACTTCCTGAAGACCCGCGAGACTCGCTCAGCGCACCAAAAAGCCTACAACGATAAGAACCGAGATTACATTCGTGCCAGGAAGCGAAA
ACCAAAAGACGAAAGTAAACCTAACACCGAACTTAGCTAATTTATAGTTTTTTATTTCCCCAATTATTTAGTCGATCTTGATACAAGACCCATCTAATAT
AAAGCTAAATCTACTCGGATATTGTCTTGATACATGTAACGGGGTACGTAGTCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGA
GTATGACACGTCATACTCCGGGCTATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTCAACGACATTGCATTTCTATAGATGACTTATAG
TTTGTATTAAACCCAAACTTTATCTACCTATAAATATACTCAGTTTTACATTCTACCTTAATTTGGTCACTTCGCTCTCTTTTTTACTAAAGAGGGGACC
TGTGAGCTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAGGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGT
CAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAATGACTTCTCCCATATGAACGACTCTCAGTTCGAGTAG
GTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCGCTCGACGCGT
ACGAGCAGGGGCTCATTGCGCATGTGCGGGAGAACCTGGAGGCCCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCC
GTATGAAGGGAAGGAAGTTGACTTCTGGGTCCGAGAGGTAGAGCTCGAGATGGACGCGGCTCTGATCTCGACCGAGTAACTTCGTGCTGCTTTTGCACTC
TCCAACCTTAGCGGCCGTGCTAAGAGTTGGGTGTA