Description :
From Genome Similarity Track
Location :
Scaffold_420:14020- 16115
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_420-fgenesh-gene-0.0Myosin

Sequence
2095 bases(100 bases per row)
ACACGTACACGGGCAAGATCTGTATCGCGGTGAACCCATACCAGTGGTTGAACTTGTACGACAAGTCCATCATGGACCGCTTTCGCGACGGCAGCCGCGA
GCAGAAGCCGCCACACGTGTACGCTGTGTCCATGGAGGCGTTCTTTAACATGCGCAACAAGAAGGAGAACCAGTCAATCCTCGTGAGTGGCGAGTCTGGT
GCCGGCAAGACGGAGACAACGAAGATCGTGATGAGCCACTTGGCGGCACTGGCAGCAAACTCGGATTCCAAGGTGATCCAGCAGATCATCAAGGCAAACC
CGTTGCTGGAATCGTTCGGTAATGCGAAGACTGTGCGTAATGACAACAGTTCACGATTCGGCAAGTTCACAGAGCTCCAGTTCACGGTGGACGCACAGCT
CATCGGCGCCAGCTCGCGCACGTACCTCCTGGAAAAGTCACGCGTGACGACGCAAGCGTCTGGCGAGCGCAACTTCCACATTTTCTACCAGTTGCTGAGC
AAGCGTGACCAGTACCCGGAGCTCGAGTTGGCTGCAAACCAGTCGTTCAAGTACGTGTCGGAGAAGGACAACGAAGTGCCTCTCGATGAAGAAGGCGATC
TCGACCGGACGCGTGAAGCTCTGAGCCTGATTGGCATTGAAACCAAGCTCCAGCAGGAGATTCTGCAGATCCTCGCGGCTGTTCTCCACCTCGGAGAGAC
CTCATTCTGCGCTGCGAATGGCGACGTCGATGCCTCGCAGCTTGTCGACTTGAAGCCGTTCACCATCGCTTGTAAGCTCCTGGGCGTCGATGTCTCCGCA
CTCGAACGCGCGGTGTGCAACCGAAACGTGTTTGTCGGCCGCGAAGTCTTTTTGAAGCCGATGACCAGCGACCAAGCGACTGATTGCCGAGATGCGCTGG
CGAAGAGTCTCTACTCGAAGCTGTTCCTGTGGCTCGTGGACCAGATCAACGAGACGATCGGTGTCAAGACGAAGGACGCAGTCTCGTTTATCGGGATCTT
GGATATTTTCGGCTTTGAGCACTTCCAGCACAACTCGTTCGAACAGTTCTGCATCAACTACGCCAACGAGAAGCTGCAGCAGAAGTTCGTCCAGGATGTC
TTGAAGACTGTGCAGCTGGAGTACGAAGAAGAGAACATTTCGTGGTCGCACATCCAGTTCGCTGATAATCAGGACGTGCTCAACCTGATCGAAGGCCGCT
TGGGCGTGATCAGCTTTTTGAACGAAGAGTCCCTGCTCGTCACCGGCACGGACGCCGCGTTTGCGAGCAAACTGGGCGCAGTCATGGAGAACAATCCGTT
GCTTGAGACGCCTCGCTTGAACCAGGTCGCGTTCTCAATCTACCACTACGCCGGCAAAGTGACGTACGATGCGACTGGATTTTTGGACAAGCACCGCGAT
GCCATCTTGCCAGACATCAAGATGTGTATGAGCACCTCCAAGCTGTCGATTCTGTCGAGTACTTTTGCCGACGATGCTGCTGGCGCCGTGCCTGCTCCAG
CTCCAGCGAGAGGTGCTGCAGGACGGAAGAAGGTGCAAGCTCAGCCGAAGCGAACGACCGTTGGCACGCAGTTCAAGGAGAGTCTGTCTCAGTTGATGGA
CAAGATCAGTCTGACGGAAGTCCACTACGTGCGATGCCTGAAGCCGAACGCGCTGAAGAGCGCCAACTGCTTCTCCCACGGAGACATTGTGAACCAGCTG
CGTTGCGCCGGTGTGATTGAGGCGATCCGTGTCTCGCGCAGTGCGTACCCGAGCCGCATTCCGCACATCGAGTGTGTGAAGAAGTTCCGCATGCTCGTCG
ATTCATCGACTGTGCCATTGCCACAGAATGACTACAACATCAGCGACTCCGCGATGAAGGTGAAGTGCGAGCAGTTGATGGAGAAAATGCTGCCTGGCTG
CAACGTGGTTGACTACCAAGTGGGCTCGACTCGCGTGTACTTCCGCGAAGGCGTGCTGGAAAGCTTGGAGACGAAGCGCGCATTGGCATTGCGCAAATTC
GCGATCATTCTTCAGAAAACGGTTCGCTGCTTCCTTGTGCGACGTCGGTACTTGAAACAGAAGAAGCTTGCTGTTGTGATTCAAAAGTACTGGCG