Description :
From Genome Similarity Track
Location :
Scaffold_534:14019- 15933
Sequence
1914 bases(100 bases per row)
CGTCCGGTTCCAGCGCCGGATGAAGGCGCACCACGACTCCTGCAGCGCACTGTGGTCGACGCCGTCCACCGGCTTCTGGCGCAGCGCACGAAAACGCCGG
AAGAGGTCCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGACCAGGACAGGGGGCCTCTTGGAGACTGGCCTTGATG
CTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCCAGTCGACGTCCTTCTGAAGGAGGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTT
ATGAAGGTAGTTGCCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGGTCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGA
ACGCCCACGTTGCTTGCGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTATAGTTTGTTCGCTCGCATTACGT
CCAACACTCGACGAAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAA
GGTACGCAAAGGGCGGAACAATTGCGTCACTAGGCGATTGAATGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCG
CTTGGAGTGCTTACCGCGGTGAGCGGGATGTCGCTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACAAAATCTAGCGCACTGTACAGGCCATGTTGTT
CAGCAACACATCCTTTCGTGGGATTGGTGTTTGGGCCAGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGTTTA
CGAACGCAGAAAGTCGGCGTCGAGTGCGGGGATTTCGATTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTT
CGCGCGGGAGGGGCCATTGCCTCGTGACACAATACTTTGTGCCGGGCGCGAGATTAATCTCGTGCCGTACGCCTCGATCAGGTGGGACCTGGGTCGGTGG
GTGTTTGTTCACCA