Description :
From Genome Similarity Track
Location :
Scaffold_75:140122- 141440
Transcript NameFunction/comments
g12307.t1XP_009535300.1 hypothetical protein PHYSODRAFT_339103 [Phytophthora sojae

Sequence
1318 bases(100 bases per row)
TACTCCCACAGCGCTAAAATCTCCTTGCGTGCCTGCTGCAACGCTTCTTCGTGCTGGTCCAGCGCCTCGCACTCAATCCCAGGGAAGTTGTTCTCAAGAA
GGGCCTTGACGTGCGGCAGATCCTCCATCGGTGGTGCGTACGTGCCGCTGTTGTTGTCGATAATGAGCTTGGGTTCACCTGGCGTGTCATTGTCAACGCG
AAACTCTCCAGCATACCTGTCCACGAACACAGCAAATGAGTCAGCATGTCTACTAACTATTCTGCTTTCCAGACGTACAAGACGGAGAACGCGGCACCCG
AGTGCAGCATGTGCTTAGACAGCATGTCCTTGAAGAAATCAGCGCCCGTTTCGGAGAAGTACCAGCCCTTGTTGGTGATCACATACGTGTAGAGCACCGG
TTTGTCTTGACGTCTACCATCGTGGATAAGCTTGAAGAAGTCGGCAGGAGACGAAATGGAGCCGTAGTGCGTGTTTTCTGGGCCGTGAGAGTAGACCACG
GCATGCTGCGCTAAGATCGCTTGACGAAGAATGGGTGACTCGGGGTGGTCTGGCGAAAAGATTCGCTGAATCGTGGGGTAGTTCTTGTTCCACTCGTGCT
CTGTTGGTAGGAACTCCGGGATATTGTGGAGCTGGACGCGATACGCCAACGACTCGAGTCTATCGTCATTGGACGTCAGCATGGACAAGAGCCCCGCGCC
GACGCTCGAGTGCACCGAGTAACGAACAGGACCGACCTCACGAAGCAGCTCGTTGTCTACTGAATTCGCTGGAATACCTTTGGTCTGCAGAACGACAAGA
GGGCAAATTGGTGTTAGTCTTATGAGCGAAAACGGCAAGTAACATGACGGACCCACCCTGATAACAAGGACGCCTGCTTTTTTGTCGGCCAATGTGATCG
GCAGCTCGGAAATAAGCTCTTGGCCGCCCGTGTTTTCTACCGTGAACTGCGCCGCCCCCAGCTCATCGTCAGCATCCATGTCCTTGTCAAACAAGGACAA
CTTGCACAGGGAGCCCGGACGGACATTTCGGAAGTAAAATCTCTCGTTCCAAGCTGGTTTGAGAGTATCGAAGATGGGTCGTGTCCAGCCCACTTTCACG
CCGTCGATCTCGATCGAAACGTAGGCGTCACTCGACGATAGCTCACCTCGGAGAGCTGCCGTCCAGCCGAGGAAGTCGCCGGCCTCGATGTTCTACAAGC
CAATACATTAGGGTTAGACCGAGAAGGTACCTTTGCCTCTGGAGGAGGGTACTCACGTTCGCTGCCACAATCTCGACGTCAAAGTCGAGAACGACGCCTT
CAGGCATGTCCAGCGGTG