Description :
From Genome Similarity Track
Location :
Scaffold_170:14012- 15295
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_170-abinit-gene-0.47EML5 (ISS)
Pytul_var.sporangiiferummaker-pug3_contig_170-snap-gene-0.19Conserved gene of unknown function

Sequence
1283 bases(100 bases per row)
ACACACAGCATGAGATTAGTGAAGGAAGGCCATGATTCACTATTTTCCGCTTTGGTTTGAAAAAAATAAAAAACGCACCAAAGACGATCTTGCCATCGGG
ACTTCGCGCGTCGTCACTCGCCTGCGGGTTTGGCAATGTGGTGCCACTCACATTGCGGCTCAACTGGAGTTTGTGCTTCTTCCGGCTTTTCAGCGCAGCA
CTCAGTCTACTTTGTCATGTTCGCACATCCACGTATTCCACGTGCACAAATCGTCAAGGCTTTCACCGTTACTGTTATAAAAACAACTTACTTTGGCAAC
CGCGAAGGTGGCGACGTCGATCCTGGTGGCACAATGTTTGAGGATGTAGTCACCGGATGGATCAACACAACATTCGTTGGACCAATGTCTTTGGACGCTT
TCGTGACCGATTTCATCCACGACCGCTTGGCGTTGACGTTCCACGTCATGTCCTCAAACTCCTTGAGCACCTTGGCCATCTGCGACTTCATCGCGTCGAC
CACATCGTTGCGTTCTTTCAGCTGCTTGTCGATTTCGCCCGTGACGAGGTTCGTGAGTTGCTGCTCGTAGGTGTTACCTGCCGAATCCCCATCTATTGTC
AAGCCATAGTCAATCAAGGATGCTTGCAATGAAGGGGGATAACCACATGCACCACAAAGAGAAGGTGATGCAGACGTACCCATGACGGAAGGATGTGAGC
ATATAATGCGCCCCAAATCGACTGGTATCGCAGCCGTATCGCTGTGTCGAACTGAAGTCGGCGCGAGGTTTGAGCGCAAAAATGGGCGGCATATTCAACG
TGAAAAGCATGCTAAGAATAGCTCCGTGCTAATAATGCCGCGCTGGGTTTTTGAGAATCAGCGATTTGTGTCTATGCGACTGACGCTCTTGGAGGCTTTC
GACTGGACTCGTACAGAATGATTTGGGGTCACGCGCCTCGCTCTGAAAGGCCCCATATACAATTTTCTGGAAGAAAAAAAAGAGATGGAGCCTGGGTTGC
CAACCGTCCAGCACTAGAAGATCTCTTCGATTGGAATCACACAGAGGCGTGCGTACCTGTAGTCCAATAATGACTCGGACACACAAGCGCTCGCGTGCAG
TTCTCCTAGCAGCGTATTTGTGCTGGTTGGTAGCGCTTGCAACGGTACAAGCAGCGCGAAAGCCACAAATCGACTACGACGCGCTTGAAAAGGCCTGGGA
GGCAGGCGATGCCGAGCAAGAGTTGCGCTCCGTTGGAGATGAACAATTCCAAAGCCTGGCGGAAAAGTAAGCACAAGTGAGAT