Description :
From Genome Similarity Track
Location :
contig_64:1401- 2859
Transcript NameFunction/comments
g9317.t1hypothetical protein

Sequence
1458 bases(100 bases per row)
AGTCGCCCAACGTAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACGCGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAA
GCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTG
TTTCCCCTGCCGTGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCATCTGGACAAACCGAATTACGGCTTGTCGCGCTGGACAAAGT
CCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGATGTTCGTTGTCGTTTAAAGTGTCTACGCC
CGTCGTAGACACTGTCTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGT
TTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTG
TGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGT
GTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCT
TGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGTGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGC
TGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGTCAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCA
AAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATA
CCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGCAATATGTCTTCTCACGGCCAGGATGTCCC
GATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAA
GCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCAC
AATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACGACATAGCGGACGACGC