Description :
From Genome Similarity Track
Location :
Scaffold_1176:1401- 2598
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1176-fgenesh-gene-0.0HECT E3 ubiquitin ligase

Sequence
1197 bases(100 bases per row)
AAGCGGTTCGAGCTGAAGCGGCGCGGCGACGCCGCCACCAAGCTGCAGGCGCTGGTTCGCCGCGTGGCCGCCGCCCACCACACGCGAGCCGCAGTCTTCC
AGGAGCTCGAGGCCGAGCTCTCGCGAGTTGTGTCCACCGTGAACGTGGCGACGACGCCGCTGCCGTCAAGCCAGCTCGAGAGTTTGCTGCGCCAGTTCCT
GTTTGCTGTGCCGAGACGCCGCGCTGCACTCGAAAAGGCCGGGATCGCTGACCCCGACAGGGTTCGCAATGTGTTCCGGTATATAATCGCCATACTGGTT
GTGAGTCTCGTGCGCGGGACGAGAGAAGAAGGCACGAACATCATCCAGAGAACCAAGACGCCGACGTGGGTGTATCAGATCGCGAGGATCGTGGAACTCG
AGCTCGAGCAGGTCGCACAGCTTGACCTGGACACGACCATGAGTCCGGACGTGCTGGTGCTCGACACTCTCACCTGCACTGGCCGGTATACTGACACGAA
CGAGGACCTGGCGGCGTTCACAGCCATGATGTCCCAAGTGGCCACGTCCGACAAGGGCTACGGCGTGTTTGACGCGCTGAGCGATGTGGCGCGGCGTCTG
CGGCGTCTGCAAGCGAATCAAGCGGAGATCGAGCGTGTGGTACAGGAGAGCCGCGTGGTGAAGGCGGTGACCACGGTCTCCCGTTCGACTCTGAACGTGG
CGCGCAATGATCCTCGGCAGCAGCAGATCCTCGGCACATTCGCACGCAAAGTGCTATTCACCCCGATGATGGGGACGTCTCCGATCATGGTGAGTCTTTT
GTGTGTGCATATGTTGTTTGATCGGATGTCTTCTTACGTGCTGTGCTTCGCTTAGGACGTCGCGCTGCCGACATCCCGATCGGATGTATCGCCGGAGACC
CGCCGACGGGAAGAGCCGCTCATGTGGACGGTCGCACTCGACTACTTGCTTACCCAGACCCAGCCGGCCACTACACCTTGGCAAGACCGCGCGGTGCTCG
TCGGCAACACCTTGGATTTGATCACCCGCCACAACTACCACCCAATGCTCCTACGCTCCGGCATCTTTCTCATTGCGCGCTTTGTGTCGCCGTCACTGGT
ATCTTGGGCATTCGACGTCCCCAAATCAGATTCAATGGAGGATGTGCCAATCGCGGATGATGACGACAGCTTCGACATGATCGAACCCGACACGACG