Description :
From Genome Similarity Track
Location :
Scaffold_39:14008- 37201
Transcript NameFunction/comments
g8277.t1hypothetical protein
g8278.t1hypothetical protein
g8279.t1hypothetical protein
g8280.t1hypothetical protein
g8281.t1hypothetical protein
g8282.t1hypothetical protein

Sequence
23193 bases(100 bases per row)
ACTTCCACTGGCGAGGGCTGTTCAGGAGTGTTCAGCTATTCGTGGGAGAATGTGTGGATTGTGAAACGGGGAAAGGGCGCCCCCTCATTCAGGGAGAGTC
ACCTGGGAATGTACAAGCTACGTACCCATTCCAAATGATCGCCATGGACCACATTCCGTCTCTACCGAAGTCGTACAAAGGGAACACAGAGCTGTTAATC
TGGGTCGACCTTTTCACCGGATACGTGATCGCAAAGGCAAGCGCCTCTCACACTTCCCAAACGATCGCCGAGAACTACGAGGAATGCGTCTTTCGGCGCT
TCGGCGCCAGTGAAGTCATCCGCCATGATCGAGAGCCCGGTTTTATGTCAGATTTCTTCCGTGCTTTTAGCCGGATAGTGGGTCAGAAACAGAGGGCTAC
GATGGCGTACCGGCCGCAAGCCAACGGGACTGCCGAAAGAATGGTGCAGACTCTAACGCGATCACTGAAGATGTACGTGTCAGACGTGAACCAGAGAGAC
TGGGACGAGTGCGCGGAGCGACTCACATTCGCCCTAAATACTGCCCAGGATCGAGTTCGTGGCGACACGCCATTCTACCTGGCCCACGGGTGGGACCCGC
GATCGACGCTGGAGGCGGCGATACCGTTAGGCAGCACGCGCCGACGCGATCAGGAGCCCCGTCGATGGAGATACCACGTACAGGTACACTACCAGCGAGC
GCGGGAACAGGTTCGCGAGCGACTGCGCGAGGCGATCAGAGGCAGAGCCAACCGGCACAACGAGGATCAGCGACCCCACAACATCGAGGCAGGCGCTCAA
GTGTGGCTGCACCTCGACCGAGTTAAGGAGGGGTATGCACGAAAGCTTGCGCACCTGTGGCATGGACCTTTTCGTGTCGCTGAGATGATCGGCGATCACG
CCGCACGTCTTGAGATTGCGGGTTCGGAGTATAGGATCTTCCCGATCGTGCATATGTCCAAATTGAAGTTGGTCCGGAGGTTCCCCGATCGTCCTGACAC
GTCGTTGCTTATGACTGAGAGCGATCGCCTGGACTTCGATGAAGCCCTTCTGCCGGAAGACAGCTGGGGGACCCCACTCGGCGAATACGAGTTTGAAGTG
GAGAAGATCGCGGATGTACGAACCGGACGCCGGACGCGCTATGGACGAGTCCACCGAGATTTCCTGGTGTTCTGGTTACGATGATCCAACTTGGGTCGAT
GAGGCGGACCTTAATTGCGGCGCTATGCTGCGCGATTTTGAACGAGGACTGGCCAGCCGGAACAGATTTGAAGTGATGCAGTCCCGTGAAGGGGAAGCGG
AAGACCCCCTGCAGTAACAGGCACTGTAGGGGAGGAGGAGAGTGAAGGATGTGCGGGATGGCCGCACATCGGAGGAAGGGGTAATTTGTGAATTGTGAGT
TTGCGATCGGGGAAGGAAGAGTCCGATCGGGGTCGGGTGACCCAATAAAGAGGGAAAGAGAGGAGAAAGAATGTATTGCAGAAGCTTATCAAGACCTTGG
AGAGGGTGACTTCACTCCGAGTCGACGACAGACCGAAATTTACCGTCTAGACGTGCGATGCGGGACCCGGGATGATCGCTCAGTTGTGTGCGATATTGGT
TGCGCCACGAGTCGGCAGAATCTGCGGTAGGAAGAGCGTTGATCAAGTCAGGGGGCGCCCGCGTGGCTCCAAAACCAGGGTACCAAAAGCACCGTTCGTT
TTGGCGCGGAAAATGAAGGAAGAAGGGATCCAGAAGCAGGTCGAGATCGCAGTGTCCGGTGATCATCCCAGCCAGTAAATGCTTGAGGATGGTCTGCCAC
CGGGGACCAGCTCGAGATCGACGCTGCTTGCACCCGAGCCAAAACTTAGCCAGAAAAGGGTTGGCCAACTTCATGGCCTTGGTGATCGGTAGCTTGTGGG
TAGACTCCCAGAACGCTTGACGAAACTCCTTTTCGAATGCCGCGTACAACTGTACGAACTCCGCGAACCATCCTGTCGCATCAAACGATCGCGACGGAAC
TGCCCGACCCAACACAATCCATGGTCACAGTTTATACAACGCCAAGATATTAGCCTGGGTGATCAGGTCGGGGTTCCAGGTGCCAGCAGAAGGAGTGCGG
GTCCGGCGCGGGAATAGCCAAGACGGCGGACGACTCCACTGACGAATTAACGTGGCGACCGTCAAATGGCGGACGCTGAGTTGACGGACCGGAGAAAGAG
GCCAAGGGTCCACGTCCGTACCCGCGAACCTTACAGGACTCCGGTACCCTGGGATCCAACGGTCCCGAGAGATGGTGGTGGGATCGAGCTGATCGAGCTC
GGCATCCGACAAGACAGAGTTCGCTGAGTCGCTGGTATCGGAGTCGCCCGAGTGGTGATCGCCGGCGGAGCTGCCTCCGGACGAGTCACCGCCATCACCG
CCGCCGTCACCGCCGACGTCATCGTCATTGTCGCCATCGTTGCTGTCACCGTTGTCGCTCTCGTGGTCGCTGTCTTTGTTATCGTCGTCGTCGTCACCAT
CGCCGTCGTTACCGTCATCATTGCGATCGCCGTCACCGTCGTTACCGCCATCATTGCGGTCGTCGTCACCGGCGTTACCGCCATCGTCGTTATCGCCGTC
GTCGCTGGCTTGGCCATCCGATCCACGATCGCTAGAAGAGTCGACGTTGATCGGTTTGCTGGGGGTACCTGCTGCGCGACGCTTAGACCGGGACAAATGT
GATCGTCTACCAGAAGAACGCGATCGAGCGAGACCGGCGTTCAGAGCGTCATCATCGTCGCTGTCACCGGGTGAAGGAGATCGGCGACGTCGAGACTTGT
GAGGCCGCTTGCGACGAGACGACGGACTTGACGGAGAGAGACGGGAAGGAGAGCGGCTGGCGAGACGTTTCCGTGATGGAGTCTTTTTCAGCAGGGAGGG
ATCGCTGGCTGGCGTGGGAACAGGTATCGCCGGAGGAACGATCGAGCCAGGTTGAAGTATGCTGGTGATGTCCGAAAGGCGCCGCAAAGCACCGTCTCGC
TCTGTGATCAGCTGATCACGCACGCTCTCCAGATCTTGTTGGGATTTACGGGCGGTTGCGAGATCGGTACGCAACACGGCATTAGTGCTGCTCAGCCGGT
GATTGGCAGCTACCGAAGACTGGAGGCTGCTCGCTCGCTGCTCCAGCCGAGCTATGGAGAGCCGAGCAGACGTGACTTGGTTACCTGCAAGAAAGAGAAC
GCGATTAGATCAACGGACGCTGAAGGATCGACACGATTACGTACGTGCTTGTGAAAGCTCGTTCCGAGCGCGATCACGTTCTTGGGTCACCTGTTGCAGT
TTCGCCGCTTGATCGCTTAGATCTTGGCCGGACTTGTCCAGTAGGTCCTGCAGTCGTTGTCGTTCCTGAAGACTCTGATCGAGGGCGCGTCGGGAACCGT
GTCGGGCTTGCGCCAACTGGTCGCGCAATTCGGAGGCGCGACGCTCGAGTAGTGCCACCTGTTGCCGGAGGATCTGCGCTGATCCCTCAAGAGCTTTGTG
AGAGGTCTCGAGATCGCGAATCGAGTCGCGAGCCTGATCCAGATCGCGGTTCGCTAGACCTTGGGCTGCGATCGCCACGTTCATCTGTGATTGGAGTTGG
AGGGTGTTCGGGTTGACCCCAGGCGGAGGTAGAACGGTGCCGCCGGAAGTTGTGCTGGCGACTGCCAATGCGGCCGTTAGACGCTTCTCCAAATCGTCGA
TTTCCCTTTGGAAGTCAGCGACAGCTTCTGCGTGTACGCGATCCTGGAGGCGCATACGATCACGGAGGTTGGTGAGCTCGGTTGCATTGTCGATTCTCTG
GGCCAGAGCTTCTCGGGTTTCCGCTAAGTCCAGGGTAGACTGCGCGAGACGATGGGACAGCTGATCGTACTTCTGCTGGACGAAGCAGACGAATGGGGAC
GCCGACTGAGCCGCTGAACGAATTGTGTGCTCCAGGTCTGCCACACGCTGTCGCAAGGCAAAGTAGGACTGCAACAAGTCGTTGTAGCTGCGCTGGAGTG
CCTGAAACTCACTCTCGCGATCCAGACCGCAGCCAACGACCTCCGGATGGTGGTCTTGTCCAGAGGCGGCAACGAGGAACCAACTTGGAGCAGCGGTTCG
ATAGGGAGAGCGCCAGGCTGACCTTCGATTCGCTGGACAGGCCTGGGAGAAGCGGCCGGAACTGTAACAGCGGCGTCATGTGCTGCAGGAACTGCGATGG
AAGGGTCCGAGGTCGTAGCCCTCTGCTGCGGCGAAAGAGATCGAGAGGAAGCTGACGTGGGCGAATGACGAGAAGGATCGCTTGTGGTATCTCTTTGATC
CGGCGAGGAGTTGCCTGACATGGTGCTGTGGAGGTGTGGTGGAGAGGAGCGAGAAGGAGAAGTGACGAGTGTACTGTTCTGCAGCCACGGCGTGTACAGG
GGGCGACTGTGGTGAAGTGGATGTTGGAAATTTCGTGATGGACCAATGATGGGCTAGGATTGGACGGGATCGGACGTACGATCGGAGGTTGATGAAGACA
GACTTTGGAGGGATTAGATTGGACCTGAGGGGTAGGGTTATGGAGACCCAATGAGTACAGTGTGGCGAGGTCGATGAAACCTTTACCGCCCAGGGGGGTT
CGTATAGCGCGCTCCAGGAATTCCTCCTCCAGGATTGAAGGGGGAAGACTTGTAGGAGTCAACAAGTATCCAAGATCTCACCGCGAAGCGAAACCTTGGG
TTCTTGGTGGCGTGGGTACCTTGCGGAATCCCTGTCGGCTCGTTTGTCTTTGACGAAACGGCACTTCACCGAGCTTGTGGCCTTGAAGTTGTGCCGAGCG
TACGTCCGCTTCAGGATGCACTCCCAACGACAGAATGGCAGAGTGTAGTCTGGATTTCACACCCAGAGTATCGGAAATTCAGGATGCACCTTTACCCAGG
ATGCACCCCAAACACCAATAGCCAACAAATACAGAGTTATATACAATACAAATAGCCGTCACTTATTCTTTTCGACCCTTGGACGGTGGGTCACTCGCTA
GGCTCACTCGAGTCTTACAATTCAGACACCTAGTCAGTCTGAACACTCGTATAAAACGCGCACCACTCTCAATTAAGAGAGAAACTATCAAATACTATAG
TCAGTCGATACACACAGCAGTTAAACTATCACTTCGGGGGACAACTGCTAGTCAGTCACCTCGAATAGCAAGGGAATATGAAATGGGCAAACACCAGCAC
GCTAGCGACCCAACTAGGATATGAAATAGGTGGGTCAACCCAGGGTGCCGGAGCGCCTCTGGTCACCACCTAACTGGACTTGATGTTATGAGGTGGAGAT
GCCACAGACGACCCGTCCTTAATGGTCGCAGCGCCCCTTGTTGCATCGCGGTCGTAGTCTCGGGTCCTCCGGATTTCCGTCGGCAGGCTTGGCCGAATTC
ACTTGCGCAGTAAGGGGTAAAACAAACTCTGTTGTTGGCTGTAAGCCTTAAACTATCAATTCTTTCTAGATCTCGGCTCTGGGTGATTTATCTTGATTTC
ACTATGGCTTGGGTCAAATTGTCTTCGCTTCAGTATGGTCTGGGTACATTGTCTTCGTAGCTTCAAAAGTGTCGACTCGACAGTTCTGTTGGGTTCGTTG
GTGGTAGTTCAATTGCGTTTCACTTGATGACGTACCACTGTCTTCGAAGTCAAATAGTCAGTGGTCAACCATCAAGATTCTGGTATTCTGGAGTCAGGAC
TTTGGAGTCAGGATTCAGGATTCAGGATGTACTTGACATCCAGACTCTTTGGGCTTCCAGCGCACGACGTGGGTGTTGGTAGTGGATGATCTTGGTTCAG
TATCTTTAGTAGTCGCTCTGAACCACAGCAAGATGAGGTACAATCTGAGATACGTTCTCAACTGCACTTTCCGCCAGTCTTTAGGCACTCATCGTAAGGG
AAAGTCCGGGGGCTGGACATAATGCGGGTTTGCAATCGTGGATTTGTACACATCCAGGATACACACTTCCAGCCAGTTGGGCCCATCTGTGGTTAGGCGT
AAGATCTTTCCATAAATCAGTCGCACTCCATACGTCACCCGTGTCGCACGGGTACAGCCGAGTCACATTCTCCATTTCATCCAATAGTATCCATGCTCGA
AATTTTAGACCAGAGTCGCGACGGCGGTGCGTCACAGAAAAACCAGGAACACTTCGTGTCAACCGCCCCTCCTGGTCCAGATCCATCAGAGAGGAAATAT
CCCCGAGCTGGAGAATCATGGCCAGGACATTCAAACGGGAGCCAACCCAAGAAATCGAATCAAACGCTGCCGTTACACTCTACCGTCTGCCAGAATTCAG
CGCATTGCCGTACCCTGTCTCTCCAACGGTCGGTCACGATCCATCTTCAATGTTCTCCTCCCGGATACTACAGCATTCACGTGCAATACGCGGTCATATC
GCGATTTCTCAGCTTGTGCACATGGCGGAGACCGGCAACGCCCCGGCCCCAGCGCCTTCCTCGACGCCAGCGGCCAACGGCGACAGCACACAGCCTCCTC
CGGATTCTGCTTCTCCCTCACACACCGGCGACGTCGAGAAGCGCCCCCCAGAAGACTCAAGCCAGCCTTCAAGTGGCGAGTCACAGGCGATCATCCTGCG
TCAGCCTGATGGTGACGACAGCGCCGAGAACGCCCCCGACGAGAGCAAAGACACTGGTGGTGGTGGCGTCAGCCCTATCCCGATGGGCGAGGGTGTCGTG
TTGCCTTCCTTCTCGCGGCCACGCTACGTGCGGATGGAAGACGTTGACGCGCTGTTTTACAAGGACGTCCTGTCACAGCAAACCGTTCGGCCCGAGACTT
TTGCGCCTCCTGACGCTTCGGCGCGTTGGACCTTACCTTCTCTGCCAGACACTGGCACCAAGACGTACTTGGTGGGAGTTCCAGCCACGGTGGACGACAC
GCGCGGCGGCGGCTTCACGATGAATGGATACGGGGGCACTACAGCATGATTGGCTTCGAAGAGATGAACGCGGACGACAATTCTGAATTCGAGCGTCTGT
TTGACATGAACACCCGTCAGTACCTCCTGCAAGCGCGACAAGATCCGCTCCGGCTGGATGCCTTGACCTCCAGTCTGGACGACATTAGCACGCGACGTGA
ATTCGCCTCGATCCGGACTCACTTTCCTCCGGTTCAACTCGCCTCGCGTGTCTTCCGCACTTCGATGTATTTGCGTCTTGTTCTGGGTGAACACCGTCGA
CTTCGGGCGCAGATTGAGCGTGGTCAGGAAGCCGCGATTAAAGACGCTGTGGAGTTCAAACGCATCAATGGTGACCTTCGTCGTGAATGGAAGTTCGTCT
GCGCACACTGGCACCAAGAGGTGACTTCTGCACTTGCCAAGGCCAACGAAATCAAGGCCTCTGACCAAGACGAAGTCCAGGCGTTGAAGGCTCGATACCA
AGACCAAATCGACGCGCTTGAGGCTGAGAAGTCCGAGTTGAAGGCCCGTGTCTACGACGCAGAGACCCAAGTTGGCATCCTGAAGAAGCGCCTGGACGAC
AGTACCATGGATCCTTGGACGCTGTCCGCCTTCATGCAGAAGCACGCTGACGTCTCCGGCAACTGGGATCGGCTGCATGATTTGTTCGTGCACTGCGTGA
ATGGCTGCGTTCCTCCGTCCGCTTGGGACACCGTCGTCAACGTCACGGCCATGGATCAGCGCAAGGCTCCAATTCCAGCGTTTCCTGCGTCTCGTCTGGC
TGTTCCAGTTCCCAAGCCTCCGGTTTCGAATCCGGTCAGTCTGGACTTGACTAATCCGTCTGGCATTCAGGAGTCCAAGTCGCATTCTGGTGGCAAGTCT
TCGCAGAAGTCGCTTACTCCAAAGTCACTCAAGAAGACCAAGTCTCCCAAAGTCCAGAGGCGACCATCGACTCATCACCCAGGCCGCGACTCAGTGCGCA
AGGCCGGTGAGAAAACCACCATTTCCAAGGAGGCTGCATGCAAAATGCTTCCTGGCCGCGTCATCTGGAAAGAAGTGCGTCCTGACGTCCGGCAGATTAT
CCTGGCTGGAATCAAGTATGAAACGGCAATGAGGCGTCTTGACCAAGACAAGCCGGCACACGGGTTCTTTAGGCAACCACAGCTGGTCAAGATGTTGGTC
AGCATGATGTACTGCCGTCGTCTGGATTTGACCCCATGGGCCAGGTATGTGCCAACGACGTATTACAAGATGGCAGACGAGCGCCTGGATCGCAAGCTGC
GTCGCGGGGAAGTGCCTCCGTCTTGGGGTAACCTGGATGACCACACCATCGTGTATCCTGATTCTGAGGCAGAGTCCGTGGTCGACGACAAGGAGCTTGA
TCCAGACTACGCGCCTCCGGCACAAGAAGTGGAGGATGATGACGATTCGGAGTCCAGTTCCAGCGAGGATGAAGAAGAAGAAGACTCGGAACCCAAAAAA
CCCAAGAAGTCGGGTGTTGAATCTGGATCCAAGCGTCCACACATCAGTTCCAGTGATGACTCGGATGAAGCACCGGCCACCTCCAGACGCAAGGACCACA
AGCGTCTTCGTCTAGACTCACGTTCTGGACACAAGTCGAAGTCAAAGGCCAAGAAGTCGTTCAAGTCATCTGGCAACCACCCTTCTCGTCACCGGTCTCG
TTTGGCTCGCAGGGAGTACAACTCGTTGACAGCGTCAGAATTGATGACTATCGAAACACCTGACGATGATGAAACATGTTGGAGACACCTTGGCATCTTG
GTCCAGTATGTCAGCACGTCCAGAAACTCGTCGGGTCAGGACCCAGGTTTTCCAGATTACGAGGTGCACAAGTACGCAAGCGACTTGGCCAAGAAGCGTT
GGGATTCTGACGCATACGTCGAATTGAAAAAGTCGGAATCCTGGACCGTCATGTTCGAAGGTCGCTACCGAGTTCTGTTCTTCCATCGTCGCAGCACGCT
GTCTCTGGATACTCTCAAGATGTTGGGAGAGATCGCGAAGTTCATGCACACAAACGCACGTGCATTCTGGGAGTGTGGACACTGGGTGACAATTGACCAA
GAAGCTGATGACTTGTCTCTCGCTATCCACAGTGGACGTGTCACTCACCGTAACGCTCTGCGTCGCCGCTACCAGAGCCTCGTGAAGCGGGCACTTGCTA
CTCCTGGATTCGTGAAGACGTTGCTGTATGAGCCTGGATTATGGAAGCTACCAGACCGATGTTGCGCCTGGATTTGGCAAGACCCGCGAGTCGAGAAATT
AGGCGGTCCTAAGTGTGATGACTTGGAAATCCAGCTTGCGGAGACTGACTTGCGAGAACCTGCTCGCACGCAGTGGAACACTGCATCCAGCAAGTCTGAA
TGGCTCCAGTATGTTCCCACGGAATTGAAGGCACGTATGCTGCCGGCTTCGGAGCGCAAGGAGAACCTCATTTGCACCAAGTGAGCGAGTGGCTCCAACA
TCCTGGATTTTAGTCCTTGTCTTTTGCATTCAATAAGTGTTTCCACTTAATACAATCCAGGTCTTTTCCATTTACTTCAGCCCTCTCACAATCACACTCG
TAATTCCATTCTGTTCACCTTGCTTTCGAAATCACTTGGTCAAGGTCGCCGTTCATAACTCCACTCACGATAAAATTCAATCAAAGTCACTTCCATCTCC
AGACTTGTTCACTTTCGACGATCTGAATCCAAAATGCGGTCATTGCCAGACTTCAGTATTGAAGGTCCGGGTGTTGGCATCTTGGACAATTTCTTGCATC
CAGGGTACTAGTTCCTTGGATGATCATCTCCAGCTTGCATAGCCTGGAAACGGGCTCTTGCGCGCGCACCTTGGTTGAACTCGTATAGTAGAGCACCACA
GTTAAGCCTCGACACAGGTAACCATTCCGTTTCATCGTAGCCCTTCCATTTCACAAGGTATTCGCGAGAGCGCCTTGATGTCCGAGTTCTCTTAGTCCAG
CGTAAATCTAGAATTCGCTCGACTTCATACTCGTCATTCTCTACGTCAGGATCCCAGCTGTCTTCTGGTAACAAGGCTGCGTCTAAATCGTCATCTTCCT
CCACGTCTATTTCCACAGCGGGTCGCTGTGGGAACAATGCTCTAGGCTTTAGTCGACTCACATGCACCCAGGGATTAACACGATATCCTGAGTTCTCAAT
CCTGAGTTCTCAATCCTGAGTTTCACTCTGAAGTCGTCGTGCATTTCCTGGATACGGAATGGACCATGCCACATGTGAGCTAGTTTTCGGCTGAGTCCGG
GCTGCACCTTCGGTATATATAACCAGACAGCATCGCCCACAGCGAAGCCAGCTCTCAAACGTTCGGACAGTTCTTTCCATTTCCTGGTTTGCTCAGCAGA
ACGCATGCGTTTAGCCTTCTTTTGCAGGTCTTTGGCACAAGCCTGAGCGTAGCTGTAATCACGCTGCAACTTCCGACGCCAGTCATACGCAGTGCGTTCC
TGGACGCTCGACGGCTTGGGTCCAAGCATAGCAGACACCGTACCGTGTGCGTCCCAGCCGTGCACCAGGAAGAAGGGGGTATCCAGTCTCGTTGCATCAA
ATGACGAATTGAGAGCGAACATCAGTCGCTCTGCATGATCATCCCAGTCACTCTGGTCGGCTTCCGCAACGTACGCGCGGATGCTTCGCACCACAGTCTG
CACAGATCTCTCCTGCTGGCCGTTGGCTTGAGGGCGATACGCCAGAGTGGCTCGCTGCTTGCTACCCAAGAGTTCCCGGAATCGCGTGAAGACCTCACTC
ATGAATCTTGGATCCTGGTCATGTCTTATCATAGAACTCGCTCCGAACCTCCTGAATACGCATTCTTCATAGACTTCAGCGACATCTTGGGCCGTCGTAG
AACTCATGGGTTTACACATCACGAACCCTGAAAACATGTCCTGGAATAGGAGCAAAAAGGTGTTTCCGCGGTCCGACTTAGGCATGTGCGTCACGAAATC
CATGGACACAACCTCGAACGGTCGTCTGGGCTCAATATTTCCAGGCGAAGGTCCAGGATTTGGAGGACGCCCCTTGCCGCTGGCGCAATCTACGCATTCC
TTGACGAATTTCTCAACATCGGCATACATACCGGACCAGTAGAATTCAGAACGAAGCTTCTCATACGTCCGCGTGATCCCTTGGTGTCCACCTTGGAAAT
CCTCATGTGCGTAGTGCAGCATATCTGAATGTAGACTCCTTGGCACGACTAGTCTGAGTTCGTCGACCATGTCACGTGGGCGATCTCTGGTAGACCGACT
CAGGCGGTAGATGACTTCCCGAGAGTCAAGCACGAAATCATCGGCGACTTTGGCAAGCTTCCTGGTTTGGGCGTGTGACATCTCTCTTACATCACCCTTC
AGGAAATTCTTGAGTTGCATCAGGAAAGCGTCCTTATCTTGATGCAGCTTAATACGTCGCCATCGTTCCGCTTGGTACTCGATCGGGCCCATCACATCGC
CTTGGTCTGGTTCATCCTGAGCTTGTGCACGAGTTACGGCAACAAGCACCTTGGCGGCCAGTGGCAGAGGTGCGGACTCTGGTCTAGGGAGATTTGTAGA
ATCAGCATCCTGGCCATTGTCGTCCTGCACTCCCGCATCCAGGATTTGAGCGGGTTTCATCAGCTTCTCGTGGATCTTGGACACCAATTGCAAGTGTGTC
AGCTCGTCCTCGTCCTCAACCTTCCAAGACTCGTCAAGCAGTAGCGTCTTAGATGTCAAGTAGTCTGCCGCCTGGTTGAATTCACGCTTAACGTGCACCA
GTCTGACAGACTTGAATCTTGGTCTCAGAGCTTCATACTCGGCTAGTTTCCTTTGTAGATTTGGTTGGTGACAATTGATCAAGGCTTGTGCCTGTTGGAT
GATGATCCTGGAATAACCGACCACAGCGATCTCCTGGACGTCATGTTCTAACACCATGTTCAATCCCTTGAGCAGCCCACTGTATTCAGCATCATTCACG
GTCACATCTTCCAAAACAAATCCTTGTGCATCTAGGACCTTCCATCCAGGGAGGCGCCACAGAATGCATCCGCAACTGCCACGGCGTGTAGACGTCTTGG
CGGCACCGTCGAAACTCAGGATGTGGTCTTCAAAGTCAGCACCCAACATCTCCAGACTGATGAGAATTATTGGTGCGACTCGACCCTTAGCCGGGATCAA
ATTCTCCGCGACTTCGTCCAGGTGTTCTCTGGGTGTGATTCCTGCATCTAGGATGGCAGGTAGTCCGTCTTCATCACGTTGCACTCTGCGGATCTCCAGA
TTCCAGTGTGACAGGATTACGCCCCACTTGACGTTCTTACCGTCTGCCGTCTTGGATGTCAGTAGCCACTTAAGCACAGAGTATCGGGTGTATACTACGA
TCTTTGGACTGTGTTCCACCAGATTCCTGAACACTTCTAGGACTCGCATGATTGAAATCACTTCCTTCTCCGCGAGCTGGTATCTCAGCTCAGCGTCGTT
CAGGACGCGCCCCGTGAAGCGAACCGGATGAATGACTCCGTCGTACTCTTGGCCTAGTACCGCAGACGCTGCCCACTGATTAGCATGCGGGATGATCACA
AATGGTCGTGTGCGGTCAGGATGCCGCAGTAGTGGAGTCGATACAATCTTGCGCTTCAGGATCTCAAACGCTTCCTTGGCTCGCGACAAGTCTCGTCCAG
CGCGTATCTGTTCGTCCGTCAGCTCATATAGGACAGCGGCGATCACGGGGAGGTCTTCGATAAACTTATTATAGTAATTCAGACTTCCCATGAAAGACTG
CACTCCCTTGAGTGTCTTCGGGAACGGCAAATCCTGGACTCCCTTCGCAATCTTTGGCTTCGCCCGGATACCTTCAGCACTAATTTCATGCGAGAGGTAC
GGGATGGACAACTTGCCAAATTCGCTCTTGGGTAGACTTACAGAGATATTCCAATAGCGTAACCGAAACAGTAAAGCGTTCAAGTCTACACACAGGTGAT
CCCATGTTGGTGCACCATGAGCGATGTCGTCAATGTACGAGCTGCGCCCGAGCACAGGGCCCATCTGAGGTGGGGCTGGGATGTTACGCTGGAAGACTGT
CATCTTATCCGTCAAGATCGAGAAATCCTCCTCAGTACTATCAGGACTCCTGGGTTCCAGAGGATCAAGTTTCAGGAAATCAAGTACGTCAGGGTCCACC
TTTGCTTCTTCCTCAGAATCCAGGCGAACGAATCCCCACAGACAGTTGTTGATGACTGCTTGATAAATGAGTGGGGCGTTCTTTAGGCCGAACGGCATCC
GGATCCATTGGAAATGCCCAAACGGACACACAAACGCAGAGATCAGCTTGGCTCGCTCGGTGATTAGGACAGCCCAGAATCCACTTGCCATATCCAGACT
CATAAATCACATGGCCGACTCAAAACCAATCAGCAAGTCATCAATGAGTGGCAGAGGGTAGTGCAGTAACTTGATAAACTCATTCACCACACGATAGTCG
ATGCACATTCTGATGTCAATCCCATTCTTCTTCAGAACGATCACAATCGGTGATGTCCACTGCGATTCAGAATGCTCGATGAGTCCGGTTTCCAAGCGTT
TCTTCAAGAGTTCGTACACCTTGAGCATCAAGTGAGGCGCGATGGATCTCGGTCGCTGAGCAACATGTTTCGCATCGCCGACGTCCAAGTCACAGACCAC
TCCGCGAGCAGGTGCAGCATTACCGTCATCAAGGAAGATCTTACGATGATGCTTCAGGATTCGTCTCAACTTGTCGACCATCTCAGGCGTGGACTTCACT
GGATCACCAACATCTGCCTCCTCGATATTGCATTCTGGAGACAGATCTTGCAAGTCAGGAAATAAGGCCAATTGGTCGCGTAACTGAGACAGGATTTCGC
TGCCTTCGCGCATATAAACTGCTGGCTCTAAGTCAAGCTCTTCAACAGTAACTCGCATACAGCGGTCATACTCCTTCTTGAGCTTGTCCATAGGCGTTCC
AGTCATGAATGCCACCGGCAAATCCAGGGAATCACTAGCATCTAGGTTGTTGCTACCTTTTGAACCGTGATCCAAGTTTTCAGCATCCGTTGCGACTTAT
GATGTCATGCATTCTGGGTTATTCTCACCACAGAGCACGGCCTCCATAATGCCGTCACTGGAACCATCAACAAAGTCACTGGCCTCCACTCCAACACTGC
GCATGAAAACAATGTCCTCTTCAAAATTGTCTTCAGTCTGGGTAGCGGCGTCCCGGGTGAAACGCACTCGACGCGTGCCTGATTCAGGGTGTAACCTCAC
CATCTGCACTCTGTTCGAACCATCCTTCGGTCGCCTCAGCAACTTTGTTGGCCACTTGTACTTTGGAGTGTTGGTGTTGGTGTACGGCGAGTCAAACGCT
TTCCGGATTTCAGCCAGACGTTTAGCACGAATCTTGGCATCTCGCGACGAAACAATTTTCTGAATGAGACTTTGCCACTCACGATACGCTGGAGATCCAG
GCCGCACAAATCGACCGGCTTGTGGAAAGGACCCGTACTCCACAATCCTGGCTAAAGGCATCTTGTCGTCGATCCAGAGTATTTAGGTCGAAACATTTAC
TACTCGCACAGCAATAGGCCAGGGTTTCGCAGCGTAGATAATCTGTGTTACCCATTGATCACCATGTCCAGCCCATACAACCGTAGATTGCGGGTTAGCC
TGACCATACTGGATACGTACAACTGAATCTTCACCAGGGCGTAAGTACATGTAACGTTGAGCATGTATTGGTAAATCCACACCCAATCGCCGTTGTGACG
ACCACCCGCACATCACGATTGTTTCTTCGTCAGGAAGCGTGACTAGTCCTTCGCGAACACTGATCCGAATCCCAGCCGCATACATGAAACCAACTTCAAG
GAGCACATCAATCCCTTCACCGATATTCGCAATCCAGACATCCAAGATGTACACCACTCTCGGACCGAGAGTAATCTTCACCTGGGCACTAGCAGAAATG
TACGTCGGCACTCCTCCCATTCCAGACACCTTCGTTTGTTTGTGCGTCCGGAGCTTGAGTCCTAACTTACGCGCTAAGTCAAGACTCACAATGCTCACGG
TCGCCCCGGTATCCAGGAGAATCTTCGTCCGATAGTCGTTCACTGCACCGTGCACCATCACTACATCACGCTTCTTTGACTCCAGACTGTGTTCTTCCCA
CCAACCATACCGTTGTCCAGGATAAAGCCTGTACTCCACGATTTCATCAGTGGTATCAGGATCCATGTAGTCTGGATTCGGTTGGCTAGGATGTAAAGTC
GGATCTTGAGCCAAAGTTGTCATGCATTGTTGGTTATCTTGGGATCTTCTTCTCAGCTCTGGGCCTACAAACACTAGGACACACAATTCTGGGGCCTTCC
TCTGCCCGGCGCGTACTGGATCCCCATCCAGCGGGCTTAGAGGTTTAACGGCTTCCCAGTACTGGCCTCGCCATCCAGGAGTTTATCCAGGATGTGGCTT
GGCAGGTCCTTGAGTGCGCCTTGGCGAGCGAGCTTCTTCAGGTCTTCCAACGCTTTCCAGTCTTCACACGGCTTTCCTTGATGCAGCTTGCCGCAGTTGT
CGCATGGTTGCGCGCGGCACATGTGAGTCGGGTGTCCCAATTCTTGACATCGGTCACACTTGATATCCTTCCAGCAGCTCTCCTCAGGATGTCCCCACTT
GTGGCACTTCTCGCAATACTTGTCCCAGTTCGGGTTCTCGCGACGTCCTGAGTTCGGCACTGGATTGCTATGAGGCGCGTGTCCAGGTGGTCTCCAACCC
ATATTATCCATCACACGGTATACCTCGTTCGTGAGCGTCTGTGTCCACTCGGCACCAGAAGGACCAGCATTCAAGGCGCCTTCGTTTGTTCTGGCGTCTT
GACTTCCTGGATTCACACCTTGGACTGACACTCCGGATTCCTCCACAGCATCCTGCATTCGGGGTAGCTCTTCTGGATACTCACCCATCTTCACACCAAA
GTCGGCGTTCTGGGTGAGGTACGCACGCTCAAAGCGCTTGGGGCGAGGCCGTCCTGGCTTCGGAAGATTTCCAGCGCGGAAGTCACGATTCCTGGACGTA
GCAGCATCACGCTCGTTCTGGGTCCACACCTCTTCATCCTGCTCCAAAGCATACTCCAAGTCAGAAATATTCTTGAAACGTTGGCCTTGCAGGGACGTCT
TCAGGCGTGTCTCCTTCAGCTTAGTGATGAACCGGCGGATGTGCTTCTCCAGACGCTTGGTTGACTTCCTGAAATCAATGTCAGCCTTGCCTGCAGCAGA
ATTCAGGCGATAGAAGAAATCTAGGGCACTTTCAGAAGATCGCATCTCCATCGTGCAATACCGTTCAGAGTACGACGCGCGGGCCTTGCAATACTTCTTC
CGGAATGCCGTCGCCAACTCCTTCCAATCTCGCTGCGTGTGTTTCGGCAGTTGGTTGAACCAATCACGCGCTGCTCCGGACAGCTTCAGCTTGAGTTCCT
GGATTCGCATCTTGTTCGACCAGGCACCTTGGGTAGCCAGGTTAGCAAACTGCTCCCACCAGTGCACACGCTCCCTGATCGCGGCCTTAGTGTCGAACTC
GCTCAACGTGTGCGAGTTGATATACGGCCGGAATGTCAGCAACGTAGTCCCTTCTGGTGTCTTCGCCGCAGTCAGGTTGTTATCCGCATCTTGTCCGAAG
TCGTAGTCTGACTCGCTTGAGCTGGAATCCTCGCTGCTCGAGTCGCCACTTGGGTCCAGATCCGCTGGCGGGCTAGTGTTCTGACTCTTCTCCTTCTTGG
GCAGCTTCCTCTTGTAGTCGGAGCGCCTAGAGCTAGAATGTGGAGTTGGTTCTGCATTGGGTGCACCTTGCGCCCTGGATGTCCCCTGTGTCCTGGATGC
GGACTGCGCCCTGGATACGGACGTCCTTGTTGTCGCCCCTTGCGCCGCCTGGACACTTTGCGCCGCCGCAGCGTCTTCAGCACCATTCTCCCTCTTCACA
TGCTTCTCTTGGTTCTGCGGGAATGGTCGCTGGACAGTCGCAAGTAATTGTGCGGCTGCGACTTCGGTCATGTTCTTTGAACCCAGATTTCCATCTCCCT
GATTTGCGACATTTGTGACATGTCTGATGACACCACTGGTTTCTGGATACACGGTTGCTGAATCAGGGGGAAGAGACCCTTCAATCTTGACTTGAGTTGC
TGAATGAGGGGGGGTGAGTTGCACGAAACGCTTGAACTTGGGCTAATGTTGCACGAAGGTCGCGCAACTGCCCAGCTTGAAACTTCTGCATATTTTTGGA
AGTCTCACGTTCTTTTCCCAGTGCAGCCTCTGCATCCTGGACTTTCTGCCTCAGGCTCTCCATTTCCGACATTTGCTCCCGCTGCACACCTTCATTCCAA
CGCGCGCGTTCCGCGTCAATCTCCGCTTGCATGCGCTCAGCGTAGGCAGCACCCAGACGTTCCTGCTCCAGGACATCAGCTCGCGCTGCATCCTAGCGGA
TTCCTGAGCTCGTCGTTCATCCTGGGTCTGGCGCGCTTCCAAGTCCTGCGCATGGCGTTCGGCTTCGAGACGAGCAGTCTCAGCACGTACAAGTCGGTCC
GTGAGTTCTTGGACATGTCGGCGTGCATCCATATCGCGCTGGTCTCTACGTCGCTCTCGCTCCATGGCTTCCAAGCGTTCTCTGGCGAGAAATTCCTTCT
GCTCATTCTCCATTCGGGCCTGCCACTCTTGCTGATGTCACAAGACGTTTAACTCGATTTGGGCTGGCCCAGAGCTGACGGACGACGCTGACCTGGAATG
CCGAGATGATTTCCTGGAAGAATGACTGGATACGGACGGTAACTTGGATCTCTACGAGTGTCGTGAACGCGTGTCACCCTTCGAGCTCCGATGTCTGCTT
CGCAGCTCACTGCCAGAGTCTTCTTCATCAGGATTCACTGTCGCCCCCCTGGATGTCACTGATGGTATCCTGGATTCGACGTGTGGCTTGGACATGGCAG
GCTGGATAACTTGCTCAGGCTGAGCCATCACGACGTCATCCTGGTTAACAAGAGCGGGGCGTGGTGGAAGCACTGTTCTGGTTACGTAAAACCCCATCGA
AGCGTCAGCAGCGGTAACACCGTCTCCACCTTGGGCTACAAGTGCTAAAGCACCACCTCCAGCGTACGGCATGTGTGACGACGCGCTCCGACCGGTTGAC
ATCAATGATGAAGACGATGAACTCCCTCGTGAAGTCTGCGCCCCTGACGTTACACTCTCATCCGAAGATCTTGAGGTGCCAATGACGCTAGGTAGCGTGG
CAGAGACTGTGTCCATGGCCTCAGCATCCTGACTCTCGACGTCCTGGGTTACGACATCCTGGACACTCGAATCTTGACGCGATTGACTCGTCGAAGATTG
GTACACTGGCAATGAAGACAGCGACGGAGTGGACAGTGCGGACGGAGTCGAAGGTACCAGCGGTCGCGGTGGTCGATGCTGAGAGCGCTTCAACCGAGGT
TCGCTGTCGTTTGATCCCCGAGGACTCCTGGTTACCCTGAGTCCGGTTGCCCTGAATCTCAAGACAAACTCTCGTCCAAGCACATCCGTGTCGTAGTCAG
TCATCAATAGATCGCCTTGTGCATCTTGAGTGTGATACTCCAGTCTGGGCGATTGCTCTTGAATCCTGGGTGCAGGTTTCTCCTCAAGAAAGGGAATCAC
CTTGAAGCGCACTCCAGCGATGACTTGCCTCCATTCCATGAGTTCAACAGCAAGGCACGCCTGAACTTCACTCGTCACACTGCGTACCAAGACATCCGGA
ATCTTGGACACATGCGTCTTGGACCATTCAGGAATCAAGTTAGAGAACTCGAAACCAGCTTCAAAGAGCAGTGTCTGCAGGACGACGACACATTCGCGTG
ACGTCAACATCGTCGGCGGGATCTGGATCGCAGTGAGATCTTGGGCAGTGCCAACACCCCAGCGGACAGGATTCATTTCGGAGATCCAGGCGTCATCTTG
ACTTTCCATCGAAGAACGCCACTTGAAGTAGTCTCCCGTCGCGAACGCCGCCTCGAAGTACGTGTTGACATCCGGCCTCGGTGTCGGCCACGCAAAATCC
ACATTCGGAGGTGCAATTCGTCCAGAATGCAACTCCTCCCAACGCCGAACTTCCCGGCGAACGTACATCACTGCGCGCTCACCATCCAGCACCACATCTT
CTGCCACAGCCGCCAGAGTTCCAGAATTCACACCTTGAGCATCAGTCCGCGACTCCAACTTGGGCAAGACGTCAGGATTTGGCGCAGGAGCCTCTGATGC
GAGTGGTGGCGAGTCAGGATACACAGCTGCATCCTGGGTCTTCTCCTCCTCCTTCACGCGTACGGACTCCCGCTTCACTTCCACGACATCATCCGAAGCT
GACGACCCAGAAACCAAGTGAACCACCTCCGGGGGCTCAACCAATTCGACGCCTCCCTCAGACGCCTGAGCACCACCCTCGCGAGTGTGCTTCTCCGGGA
CGCCAGGCATCCCCAATCCTCGACTCACGTTTGTCGAACCTCGCATCCTGGACGAATCTTGGTCCTCCTGGGTTTGCGGTTCAGCAACCGGTTGATCTTG
AACTGGAAACACCACGGCGTCCCCACCTTGCGCTGCCTCGCTCTCACGAGCAGCCTTCCGCGCAGCCCGAGCCTCTCTGGAAATGGTGTCCAGATCCTTG
TGCTCCTCTGCCGGCAATCCTTGCACACGACGCGACTGACGTGACGCCTCACCGCGTCCGCTACCTCCGCGTCCAGCCTTCTTCGGCCCTCGTCCTTCCG
GCATTCTGAATGAATCCAGACATTGACGGGCACTCAGCAGTTCTTCAACACTTGGGCTCGTTGAAATCCTCGATAATCAAATCCGGGCACGCGCACCAGC
TGTGGCGAGGTCGATGAAACCTTTACCGCCCAGGGGGGGTTCGTATAGCGCGCTCCAGGAATTCCTCCTCCAGGATTGAAGGGGGAAGACTTGTAGGAGT
CAACAAGTATCCAAGATCTCACCGCGAAGCGAAACCTTGGGTTCTTGGTGGCGTGGGTACCTTGCGGAATCCCTGTCGGCTCGTTTATCTTTGACGAAAC
GGCACTTCACCGAGCTTGTGGTCTTGAAGTTGTGCCGAGCGTACGTCCACTTCAGGATGCACTCCCAACGACAGAAAGGCAGAGTGTAGTCTGGATTTCA
CACCCAGAGTATCGGAAATTCAGGATGCACCTTTACCCAGGATGCACCCCAAACACCAATAGCCAACAAATACAGAGTTATATAGCCGTCATTTATTCTT
TTCGACCCTTGGACGGTGGGTCACTCGCTAGGCTCACTCGATTCTTACAATTCAGACACCTAGTCAGTCTGAACACTCGTATAAAACGCGCACCACTCTC
AATTAAGAGAGAAACTATCAAATACTATAGTCAGTCGATACACACAGCAGTTAAACTATCACTTCGGGGGACAACTGCTAGTCAGTCACCTCGAATAGCA
AGGGAATATGAAATGGGCAAACACCAGCACGCTAGCGACCCAACTAGGATATGAAATAGGTGGGTCAACCCAGGGTGCCGGAGCGCCTCTGGTCACCACC
TAACTGGACTTGATGTTATGAGGTGGAGATGCCACAGACGACCCGTCCTTAATGGTCGCAGCGCCCCTTGTTGCACCGCGGTCGTAGTCTCGGGTCCTCC
GGATTTCCGTCGGCAGACTTGGCCGAATTCACTTGCGCAGTAAGGGGTAAAACAAACTCTGTTGTTGGCTGTAAGCCTTAAACTATCAATTCTTTCTAGA
TCTCGGCTCTGGGTGATTTATCTTGATTTCACTATGGCTTGGGTCAAATTGTCTTCGCTTCAGTATGGTCTGGGTACATTGTCTTCGTAGCTTCAAAAGT
GTCGACTCGACAGTTCTGTTGGGTTCGTTGGTGGTAGTTCAATTGCGTTTCACTTGATGACGTACCACTGTCTTCGAAGTCAAATAGTCAGTGGTCAACC
ATCAAGATTCTGGTATTCTGGAGTCAGGACTTTGGAGTCAGGATTCAGGATTCAGGATGTACTTGACATCCAGACTCTTTGGGCTTCCAGCGCACGACGT
GGGTGTTGGTAGTGGATGATCTTGGTTCAGTATCTTTAGTAGTCGCTCTGAACCACAGCAAGATGAGGTACAATCTGAGATACGTTCTCAACTGCACTTT
CCGCCAGTCTTTAGGCACTCATCGTAAGGGAAAGTCCGGGGGCTGGACATAATGCGGGTTTGCAATCGTGGATTTGTACACATCCAGGATACACACTTCC
AGCCAGTTGGGCCCATCTGTGGTTAGGCGTAAGATCTTTCCATAAATCAGTCGCACTCCATACGTCACCCGTGTCGCACGGGTACAGCCGAGTCACATTC
TCCATTTCATCCAATAGTATCCATGCTCGAAATTTTAGACCAGAGTCGCGACGGCGGTGCGTCACAGAAAAACCAGGAACACTTCGTGTCAACAGTTGCG
CCATCAGTCATCGGTGTATACCGGTATGGTGCGATCATTTCGATATGCGATCGTGGCCACAACTGCGATCGCGATCCCGATCGCAAATGTCGATCGGGGC
GTACCACTTTGGTGATACACCCGCAATCATTCCGGAGTGAGGGATCTTTGAAGGTACCTCGGGAGATGGGTGAAAGAATCCAGTAAGGGGGGAGAATAGG
AAGCTGAGATCATTGTTTTTACCTAATTCGATAAGAAGAAGCTTTCCCTTGCAACACAAGTGGCGTTCGTTCATTCCAGGCTGGGAAGTATATTGGCCCT
CCTGACGACTTCGGACTCACCTCGTCGCGCAAGGTAATTACACGGGAGCCCCTGGATCGCTTGGCCAGGTGCGCATCCACTTAATCCCCCCCCCCCAGAA
GACCCCGCCATAGGAGGCGGCAAGCACGTAAAGGAACACCCCCAAGGACACCCCCCACGCCGATCAAGCCCCACCAGGCCCCGATCGGCAGACCACCGAC
GACCGCGTGAAGAATACCCGCGTGGACGTCACCCCCCAGTTCCCCGGAAGGAGCCGTCCAGCTCCCCACCCCATCTTGGTAACCACCGACGCCTTCAGTG
AACACCGGGAGAGCGTAACCCGCCCCGCCGTCGGGTACACAAGGTGAATACAAGGTTCCGATCACGCCAGATCAACGGAGTACCCCCTCCGATAGTCGGC
AGTCCGGAGGCATCAGCTGGCAAATCTGGAATCGTGACAGCAATTTTCGTGATCCCGCTTCGCCACAACTTCTCCGACGGCGTCTTGTCGTTGAGTGCGC
GCGTTGCACTCATGTTGTCGATGTCGACTACGTATTGCTGTACTTCAGGCGACAACCGTGTTGGCAAGTCAGCAGCGTGCATCAGTGCACGCGTCTTATT
CACCAGCAATCCATTGAGTTTCTCGACGAGAGCGTTTTCCTCTGGGGTATATGGATGAATCGGCACGAAGCGAATTCCACGTGCTACTAGAAAAAAAAAT
ATTCCGTTATTTACGAAGTCACCTCCACCATCACTTGTAAAGGTCTTGATCCGATGTCTTTGAGCCAGCAGCTCTGTCATCAATTTAATTGTGCTAGCGT
TAGCGTTGCTCTTTTTCTTTAGCGGAAAACACCATTTGTAGCGAGATCCTTCTTCTTGAATCAGCTGAAGTAGCGAGCTCCCCCGAAACCCGGCAAATAT
TTCCCATATCACAGGTGTCAGATCGTAATTCACTTTGGTACGCTTCTTTGCAGTACTTGCCTTGTACGAACGACGCTTCTGTTTAGCAGATATGCAGCTC
ATGCAAACAAATTTGCTCTTGAACTGTTCTGGCGGGATTTTCATGCCCTTCACACTGCCATTCTCAGCCATGTGCTTGATTGCAGCTACATTCAAATGCC
CCAGGCGTTCGTGCCATCTCATCAAAGGGCTCGCGTCTGCGTTAATTGCCAGCATCGCTACTCCATCCGCCACTGCATCAGCTTCGATCGTTTTTAGCTA
ATAATGAGATCCTTACTGAAAGAATCTAGTCGCTCATCACCCCGTACTAAGAAAATCTTCCGCAACCTCGTTTCGGGTGAATTTGTCGTCATTATCCATC
CACTTTTCTCCATCACACCCAAGCTCAAGAGGCTCGTTGTGCCGTGTGGCGCGTACGCGACGTTCTCCAACTGCAAGGTCAAAACTCCGTTTCCCTTTGA
GTTTAGAGTATGAAGCAAATCATTGCCACTCATAACGCCGCGCGTTACACCTCCTGTCCAGACTTTAAAACTCGCTCGCGATTTCTTCTCGCT