Description :
From Genome Similarity Track
Location :
Scaffold_4:140031- 164772
Transcript NameFunction/comments
Phyke_g434conserved hypothetical protein
Phyke_g435hypothetical protein PHYSODRAFT_470887
Phyke_g436hypothetical protein
Phyke_g437hypothetical protein
Phyke_g438hypothetical protein PHYSODRAFT_309454
Phyke_g439hypothetical protein
Phyke_g440conserved hypothetical protein
Phyke_g441hypothetical protein PHYSODRAFT_322325

Sequence
24741 bases(100 bases per row)
GGGTGCTCTACCTCAGCTCCCCTTGAGCTCATCTGAGGAGATTTTCTGGTCCTTCCGGAGCCATCTCAccgctgcagcaaacacgTCGAGGGCTTGTCGC
CTATGCGGAGCTAGATACTTAGGGTCCAATATCTGATGCATCAGATACAAACTGCTCACTGGATGAGTAGCTAGGAAGGTCTTGCGGccttggtgctgca
gtgtagccagcagctccactgctgcaagttgaTGGTCCGTCGCAGCGACAACTGCAGTTGGTGAGCTATCGTGATGAAGAGGCACCGCCACCAATTGACA
CACAAGGTTTAACAACTCAATGGGGCTGCTACTTGTGCACGGGATGGCGGTACTGCTATCGGCGACGCCATGCGGCGTGCACTGCAACACACGTGCAGCC
GCATGTGCGTCCTCCATGGCACAGGCGCGTTTAGTCTTAGAAACAATTTTGAGATAAATTGGCTGCACGGTCAGCGCCACGATCTTCTCGTACACAATGG
AGTGCAGATCGACAGAGTTCTCGTCCAAGCCACTGATCTGCACGAGTTCCGTCATTTTGTACGTCATCACTTCCTTGTGCATCGTCGCCACACAAAGCTG
GATGCTTTGGAGTGCCGGACCTACACCCGAGATCCACACATTGTGCTTGAAGTCTAGCCAAAACTTGTGAAGGAACCGTGTGACAGGCTGACGGTCGTCT
ACCAACAGCGCCTCGAGGGCCATTTCCACACGCTCACGAACGTCCTCCACAGACACGAGCAAAACACAGATATGTCGGAATGATACGAACGGCAAACTGG
AGTCGTCGCTGGAGCCCATGGAGATCTGTGAATCAGTTTTGTTGCTGAAAACTGacgttgttgatgcagtcaTCGCTATTGATGTCGCTGATGCGACCCG
GCCGTTTCCATTTGTCGTTGAAGCCAGCAcgaatgaagacgatgcgGCACTAGCCACGTTGGTCTCATTCGCTAGAATTTGCTGTGAACGCAACTGATGC
AGTCGAGGCGTGGCAAAGTCCATGTTGAGAGtctgaaaaaaatgctgcatgCGTTTTGTCATTGCAGCCGCCGATTCTGTTGGCGCTGTTTTGCCACGTT
GGGGAGCTCGActtggacgaggagctggtTTAAGAAGAGCGTTCTCAAGAACGTTGAGTGTCATGTATTGCCGCTCGAGTTTATCCAAgtccagcatctt
cttcggGGTGAAGTAGCTGATTGAACGCCACCGCTCGAGCATGACCCCAATGACACCAATGAATGGGATAATGGAAGTTGATGAAACATCGCTGGAGAGC
AGTGGCCGTGCACTTTCAGTGCTCTGTTTCCGTCGTAAATTCTCAAAGCCGCCTGCATGATCGCAGAGTCGTCGCAGTTCACTTAAACGCGTCTTATACT
TTGCCCGCACCTTTTTCCACGTTGTGGGCATTCGCGAGGACATAAGTGGTGTATCTCCGAGGCAGCCTACGCAAGCCATCACCAAGTGGAAATTGTTGAG
CGGTGGAGCACTCGCGGCCATGGCAATTGAGATGATGTCCTCAATGACCTCGGCACGGTCTTTAGGAGTGTCTTCAACCAGTACAGACcacacaaaatat
gcaaccAGGCGGTTGAAGTGGTCTGTCATCTCTTTGGCAGCCTCCTTAGGGTGATGAAGAAATTCCCAAGGATAGACATTAGAGAGCTGCGAGTGATGGA
ATATCGTAAGCTGCTCGGCCATCTCGGAGCAAGAAATTTCCCACAGTACAGTTCGCAGGGGCTCGGCAAGGCGCACCTCCTCGCCAGCTATGAGGTCAAA
TTCATCTTGTGGTGCAACGACGAACAGCGTATTCGTGGCAGGAAGCGTGCTCCCTTTTCCACCAAGGCCCTTAGTGTCCGCGAGTGGTGCAAACAACACA
GACAAATTGTCACGCAACCGTTGGCCACCCTCCTCAATTTTGTTGGGACCGAGGGAAGCGTTGTTGtcgacggctgcagcttgcaTCAAGCCCGTGGTCT
TGGCGAGTTGAGAGATCCCAGCCAAGTTTGGGAACGAATGGTTGCGTCGCTTTTTCCTCAAGTTTGGAGCACGGGTGGGTGGTGACACACTAGTGGACAC
ATGAGCTATAGAATTGGTTTCATCGGCGTCGTTTTCACTTTTTGCGGTCACTCTGGACTCCGTGTTAACACCACCCGAATGCAGCAGCCGAGCTTGTTGC
CATTCCGTATCATCGCTAAACCGCCTTAGACGACAGTGAGGGAAGAATAGATCCACAAGCTCCTTCACGACCTCAGTATTAACTTCCTCACGTTTGGAGT
AGATGGGGTGGAAAAGGATGTCCCGAACAAATGCTGCAATGTGGTGCTTCTGTATGCTCACAGAGCGTGGCGTGAATGATCCGTTGCGAGGATTGTCCCT
TTGCTTCTCTCCCAAGGCCAGCAATATATCGCTGACGCTGATACCAGCATTTGCCACCACTCCGAGATGCAAGAGCACAACACGCCCGCCATATGGCGAA
CTCTCAATCAACGTCAGTAGAGCTCGAAGACGCTTCCATCGAAGTTCCTCTTCGCTGCGAGTTGCATTCTGTTTGGCTCGTCGCTGTGAAGGCGAGGCAT
TTGGTATTGCTGTCGTATTGGCAGCGTCGCGTGGGTTCACAAAGGAGTCGATATCGGCTGCTCCCATTGAAATATGGCACTGCATGACCGAGTCTCGGAC
ACTTTGCAATGCAATTAGTGCATCATTGTAGCCTTCAATATCCTCCTCCATTGTGTCACTTTTCTCCGTTCCTAAGCTCATCATGGAGCTCCGACGAGTG
CGTCCTGTGTGATCGTCTGTTTCTTCGCCTGAAAGGAGGTCGGCTTCATCCTCATTGCAATCTGCATCCGACCCAGGGATTTCTTGTGCGCTCACAATAG
CACTGATCCACTCATCACGCGTACTCGATGAACGAAAACCTAACATGGTATCTCGCCCGTGCATGGAAATAGTAAGCAACGACTGTCCCCCGTGGAATGT
GAGCTTTACACTGGTATCGAGCAGGTCGATCTGGCAAAAGCAAACCCCAGGCATGAGTACGAACGATAATAATGCATGCCAAGTGGTCAAACACAAGTAC
TCACCTTCGCCTTAATCGCGCCATCTCGTCGGCGGCGGATGATCATTTCGCCGGTTCTGATAATCACAAAGCGGTCTcgccactgcagcaacagagaaTA
ACACGTTAGACAACGTACCAACAATATTCGTGTCAACGTAGAGCCATTCTTACTATGAAGTGTCCGCGGACGGCTACTGTGCCTTCCTTGATCGTCTCGA
CGGCGTCCATTCTATCGTAAACACAATGCAATCAGTTGAGTGCATCACCACAATCACTGAAGCAAGGAGATCATGTTTCTTACTTGGACGATGAAGCTAC
GAGATCCATAGCGCAGTAAGTAGGACGAAGATGACCGTGATGCACTCAGGTAAATAGATAGATGGTCGTTTGGTTCGCAACGGTGTGTCGCCGGGACAAT
GGACGACGCCTTCACGACACTGCCCCAGTCGCAATCAGTAGAAGCGGGAGGCAGTTATCCACACCCACCGCCTGGGTCTCCTGGCTGTCCGACTTTCGTT
CCGTGTACGAGCAATCTCTTCCACTCTGATCATTGCTAGCACCAGTCTATGCAGTATTCTTAGCAGCTGGAAGCACGACAATCGAGCCATATTGAGAGTC
GTAAGTTTCCATCTGCTTTTAGCGCATGGTAGACGATAGCCGAACGTTAGGCCTCCGGTGAATTATCCGGACAAAAGTCAAATAGTTATCCGGACTCAAA
CGCATCAATTTGTACATGTAGACGAAAGCGTAGGACGAACATAAAATAATAGCATGAAGTTACATGTGAAACGCATTGATAAAACGGGACAGCTCCTGGC
TCAAATGGGGAATATTTCGAGACTTAGACCGATGTTGAGCTCGCTGAGTCAGCATCTTCCTCCCGCTTTCGCTTGAGCGCACTGCTTGGTGCATCGTCTG
GCTTCGAGCTTGAGGcatccttctcttcttccgaATCATTCTCGTCAGACGGCATTTGTGCTGCCTCCGGCTTCAAGATGGTAAACCGCAGATCGCAGTC
TGCTGAGCTCGAGTGATTTTTCACGTAGTAAACATTGCCGGCCGGGACGTAGAACTCGTCGCCAGGACTGAGCAAAAAATGGGTCGTATgcttgctggtg
aagaaatCATCATCTGTCTCCGGTGCAAGCGCCAACTCCAGCGACTTTGGTTGGCATCCCGTCACGTAGAACAACTGCACAGCTGCGCCGACGCCTTCCG
GCTCCTTCCAAGCTCCAGGGGGCAACACGACACGCCCAGAAATCCATCGCGCAAAAGGTGTCGGGCTGAAGAGATTGAAACTCTGCCCTGCGTACGCATG
CACTACTGCCCCGCCCCGTTCCTCGGTGGGAAGCTTGCGGAGGCGGATCTCGCTGGAACGGCAGAGTATGTTTAATTCATTCATGCAGCCGGCCTGGCTG
TCAAAGAGCGTCGCCCACTCACTGTCCACAATTCGCTTTCTCACGTCTGAAGGCAATTCGTCGCGAGTTAGAGCTCTACTGTTGTTAGTCCTCCGCGACG
GcgccttggccttctttcGATCCCCTTTTTTCGGAGAATCCGCTCCGAGGCGCTCAATGCCAACAACCGTTGGCAATACCGTACCCACACCAACAAAAGT
ACGCTCGTACACCATGTGCTCGCTTTTGAACCAGGCCAACGGTTTGAAACGCTTCCGCTTTGATCGACGCAGCCCactgccatcgccagcatcacTATCA
TCATCGATATCATCCAAAATTCTGGAAGCGTCAGGCAGTCTGTCCCTAACTGGGCCAGTTGGCGCATCTGGCTCGTTGTAAAAGCTATCGTCTCCAGTTT
CACCCCCGGTGTCGCTTCCTGTTTGGAAAGATTCGTCATTATCATCATCTGTCTGTGCGGACTGGACGGAAGTATCCGTCGCGGGTGGGGTCGATCTGTA
GCCATACTTGCCAGTTGGCCGTAGTCGTGGAGTCTTAGGGCGGCCAACTGTCCGTTGAGTAGTTTTCTTAGTCTGCTTCCCTTTCTTTGCTGGCTTCTTT
TTCGCGCTGGGCTCGCTTGCATCGCTGGCGTATCCACCCTTCTTGAAAAGCTCCTTATTGATGTTCGGCGAGGCTGAGTTCTTGTCCGAAAATGACGGGA
TGGATTTCAAAGTACGGTCGCTCGCTACATGTTCAACACAACAATAGGTCAAGGGATTAGTACAAACAGGACAATACTACTACCTTTAGCTCGCATAACA
GGCAGCAAAGTGTACCATTCGACAGGGGCGTCACCGAGGCTTCGTTCATGGAAAATGGGCTCACCACTTCTGCGTCAAAACCGCGCACATCGCCAAACGT
TTCTCGCCGACGTGCCTTTGCTTTCGCCTTCTTATCTTCATTATCACCCTTCCCAGAAGATTTCTTGCCGCGCCGATCGCGTACAGTTACGTTCGCGTCA
TCCATATCGTTCATATCGGCAGATCCATGCGGAGATCCACCGAAATCAAAGGACACATCGCTTCGTACAGGAGACGCCGGGGGAGGTCCAGCATCTTCCT
TCCTCTCTTCTGCCACACGGACGCTGCTCCTCTGTGTACGCGACGGGATCGCGCCTTGCTCGATATCCATGCTCTCACGGTCGCTTGATAGTGGACTACT
GACTTCAGGTATCTCCACCTCGTGTTCGCTGGCATCCGACCCCTCCGCAGACGTGTCTGCAGACTCCTTATCAGACACAGTCAGAGCTGACAAAAACACA
CAAGACACAACTGTCAGCACATCACTCCATAACAAAGAGAAGAGGTATGCAAACTCAcagtcatcatcatccaccGAGTCGTCCTGTAGCGAGTCTTCGT
CCACCCAAAAATCATCAACGTCCTCAAATCCTTCAGCGTCTTTGCGGACATCACGACGGATAGCAGCACCTGGTAGTCTGATATTAAATAGAGTGGAAAC
ATCAAACAGTCTCCCTTCAGTATAGACAGCTTCTGTAGTCTCCAAGTCCTTCTATTTGGCTGCGTACGCTTCGGTTGACTGTTTACTGGCCATGTACTGT
TTGAGTTTCTCGGCGTCCACGCTGGCTCGGTCATTAGCCGCTCTAAATAAAAAGATGGGGGAAATATTATACAGTTAAGTGTTATTTTGTTCCTGCATGA
AGCAGGGCGACGTACTTTGTCCGCGGCATTAACGTCTCGATGTCCTCCATGGCCACCGCCAAAATATAAGGGAGCTTGGATTTTCAAATTTAAATCGATA
ttatgtgtaccacacaTTCAATATTTAAATAAGCTCCACCAATTAGATTGACGGGATATTGACAACAAATCTTAACCGCAATGTAACATCCGATTCTACC
GCGGGTTCGGGCCAGAAGTAAAATTCTCTATAATATCCCGCGATTTTGGCGCCAGTGCGATATTCCGGGCCAGTGGTTACATTCATAGACAGCATTTGAT
CAGCCCAGTCACGAACAAGCAAGCCAGATCAGCCGAAACGCCCTCggattgctgcagcaaagcagaGCGGAGAACGACAGGCCACGCACGACAGCCAGCC
TTCGAGACAACAGGTCTACGAGGTAGTAACCTATCGACCCCAGACAGATATCAGGTTGGCGCCTTGTTGacagaagcagctcaagaacatgCAGAGCGCG
ACGTTCACAGTGGCGTCTACTGTACTGGAGCAGGCGTACAAGGCCATCCGTACGACGCCGCCAGAGCCCAAGGACTTGGAGCAGTCGGCCAAACTGCAGA
CCTTCATGGACGAGAAGTTCCCAACGGAATCGGCGGAGAATATCACGCGTCGCTCGCTCATTCTGGCGGAGCTGCGGTCTATTTTCCGCCAATGGGTCAA
GCAGGTTTGTATGCAGAAGGGCGTCCCAGAGGAGATGGCTacagatgctggaggacaGATACTCGTCTCCGGTTCTTACAGACTGGGTGTGAATGAGCCA
GGAGCTGATATTGACACTATTTGCGTGGCGCCACGTCATGTGACGCGAGAAGATTTTTTCTCTTCTTTAAAGGACATTTTCCTTAAACACCCCAAGGTGT
CAAACCTGGTGGCTATTGAAGGGGCGATCGTGCCTCTTCTTACTTTTGACTATGAAGAGATTAATATCGATCTACAGATTGCGATTTTGCCGCGGAATTC
CATCCCGGAGAATCTCAATATCTTGGATGATCATGTACTGGTGGGTGTAGATCCAGCGACAGAGAAGAGTCTGAACGGCCCCAGAGTTACAGAGCTGATG
ATCAAGTTGACGCCCAACCGTGAGAGTTTCATCAGTGTGCTGCGTATCGTGAGACGATGGGCCAAACGTCGTGGACTGTACTCGAACAAGATGGGGTACT
TGGGTGGTGTCAATTGGTGCATCTTGGTGTGCTTCATCAATCAACTGTATCCGACTGCGGCACcctcgacgctgttgttACGCTTCTTTATGGTGCTGAC
CAATTGGAAGTGGCCGCTGGCCATCCAGCTCTGTAAGACGCACGACGCGAATTTAGGTCTCGAGATCTGGAACGCCAACGCAGGACACAACCGGCAAGTA
CCCTCATAATCCTGCAACTCTTTCTTTGTCTTACCTGATAGCTGACGTGTTTCCTGGTGTTGATTTTCTGTTAGATACCAAGTGATGCCGATCCTGACAC
CGGCATACCCATCTATGAACTCGTCGTTCAACGTGTCGAACCACACTCTGGCTGTGATGAAAGAGGAATTCAAGCGCGCTTTGACCATGGTCCAAGACGT
GCTCAGCAAGGGCGGCTCGGATTGGTCTTCGCTTTTCGATCCCACTGACTTTTTCGCCGTCCACCAACACTACCTCGCGGTCGAGGTGTACACAGAAAAG
CAAGATGAGGAACCAGCCTGGTGCAGCTTTTGCGAATCCCGTATACGTAAACTAGTAGAGTCGCTGGCCTACAACCCGGCGCTGTGTCGCTTGCGTGCGT
TCACGAAGAAATTCCCGCTAAACTTCGTGACTGCTGGGGATGCCTCCGCTGGTGGACAACCCAACGGTGATGCCTCAACGCAGCCCAGCAAATTTGGTGT
ATGCTTTTACGTGGGCTTCGATATTGATCGTCGCCAGCTGCACAGCCGTGAGGTAAGCATTGATAATTCGGTGgagtacttcaagcacaATGATCTTTAC
CGCTGGAACAAGCGAACCCCGACCATGGACGTGAGGATTACGCCAATTGTGTGGAAGTCGTTGCCTGAAGAGGTGTTTGAAGATTTGGGCGGTAGAGCCA
TTGCGCGTGTCACGCGTCGTGAattcatgaagaagaaaaaagaggAGGACAAACTGGCCGCAGCACCAAGCCCTCCACCTTCTGGTGATGAAGGTATGAA
CGATTGTCTCTCACAAGAGATGGATGGCGACAAGGATGTGGGCGGTGATGACAAGGCAGCTTCTCTTGCAAGTGACATGGCTAACGGGAAGGGGAGCATA
TCGCAACCAGGAAGTCCTGATCCCGCGACTGAAGGAAGTGAAGTGATCAAGGACACAAACTCGCTCCACAGCACACCGCTCAAGGCTAAGAAGGAGGCGG
CGACGGTGTCGCCCGAAATGTCAGGTAAGCGTGATCGTGATGGTAATGCTGTGGTTGGAACTGGCAGCCCAGAAGAGAAATCTCTGGGCACCTCTAATGG
TGTTGGCAATACGTCAACAAACGGTGCGGCTGCTCCAGGGATAACTTCACCTCCcgtgaaggtggtgaagaagccCCTGGAGATGGCAGCGGCTCCCCCA
GCCGTGGCATCACCGCGCAAGAGACGTAAAATGAAAATCACTTTTGCCAAACTGAATTGAGAAGGTTGTGCcgaagacagtgacgagGTGAGCAACGCAT
GGCAAAAAAAAGAGGGGAAAAAATGAGTACCATGATGTGCCTGCCACTCAGggagaaaaaaaaagagaaaaTGATCCCACAAAAAAAGAggtagcaacag
caacagcatcgaggATCTACACCGGTACTTCTCGACGATCTGGCGAGCGGGGTCAACGTACATGAGTAGGCTGATCTCCAGTTGGCAAACTCCATTTGCG
TATGTATGCTTCCAGGTTCGTGAACAAGAGCGACACACCCAGTACAAGACAAGCCGCGACGGACAAACAGCTGGGCGACGACCAACTCCATTCTTCGGAT
AAACCAGGCTCTTCGGTTTATGCCGGGTCGAGAACGAATAGCTAGGAAAACGCGCTTGAAGGCAAAACCGGGTCACGTTTCCGGGTTAAAGCCTGCAAGG
CAAAAAAAAATTAAATAACACTACGTTGCAAAAGCATTGTTCACGCACATTCACTCATTCCATTGAATGCGCTTGAGTCTACACGTACACAGGCAGCAGA
CGCATCGCAGATTTTTCTATGACGCCTTCAGTTCGAAAAAAGGAAAAATGATACCAGCTTCAGCCAAAACGTCTTCTCAGCCTCTGTGAGTTCGTTCTGC
TCGAGAAATGCCCTTAACTGGAAACGTGCCAGCAACGGAATTGCATCCGCCGACTGAGGTTGGACTTGGGAGCATGCAGCCAGCACACGCTGGAACTTAG
CCTTCCAGTCTTTATCAACGATCTGTTGTTTCCCTGGCACTGGTAACGATGACACTGACGGACCGGCGAAATACTGTGTCATCACAGCCACCAAAAATGT
ATCTAGTGTTGACTGGCCTTTCAACGCTACGCTCGAAGACGGCGTCGAAGGTGTCAACGGCGTGGCCtctaccagcagctggacTCGCGCTGAAGCCAGC
GACGTGATAGCCAACGAACATCGTTGCCAGAGGGCACGTAGAGCCTCCTCTGTTTGGTTCGAGAGCCACACTCCGAAGTCCATTAACGATGACTTCTTTT
CGAGAAATTCAGACCGATGAGGCTTTTCTGAGCCTCCCTTGCAGTTTTGTGTGATTTCGGGTGAGGGCATTGCTAGCAGTAATTCCTCAAACGGAGGTGT
ATCCAAGCGACAGTAATCACAAAGTTGACTCAGCGTCACGACTTCTGTGGTGCAAACCAACTGcggcacttgctgcaaacgGAAGAGCGCATGTAGTGCA
TTGAGGAACGGCGGTAACAACAACTGCACTTCCTCTCGTACGCGTTGTAGTGCTCTTGGGCTCAAATGAGATGCCCACCAACTACTACCCCAATCAGCCA
CGGCCAACTGATTCAgctcgtcatcgccatcctcgCAGCTATCATCTTCCGTGGGATTGTTAGCAGCAAAATACGACCGAAAAAGGTGCAGCAGTCGGTC
ATCGCTATTGCTTCCGTCAGGTTCCCCCGTGCGCAGGTTAtccagcagttgcagttcAGCTGTGAAGTTCGCATTACTCTCAATATCTTTCCGTTGTCGG
CGCTTGAGAAACACTACGTTCGTATTGCGTAAGAGTTCCAAACGGAGAGCGTTAGCAGTTCGAGCTTCACCACCCGACGTAGAATCGGCCACGTCGAACG
ATGGTGATGTACTAGTAAGTATCTCCACTGGGTAAAACTTGGGGTCGAAGATAGCAAGGCGCTTGATTGAGGCGACATCCGGAAGCAGACAAGGGGTGAG
CATGACTTGGGACTTAGGTTGACTCATTTGCGCTGAAACAAAGTGTTCGTCATCGTTGCCAGGAAGAAAATCGACGCGTAGTTGGACAGCACAGGTCGTT
TGAGTGTTCACATCCACAGTTTCCAGTAGTCGTGACGTGTCTACTGCTAGAACGTAGAGGTGACGGAATGCTTGTAAATGGTACTTGTTATCAGCCGTGT
TCATTGGAGCCATGGGATATAGCGAAAGGACAAGTGCCGCTATAGCTTCCTTCGAGCGCGACACGGTTGCACGCCCGCCACCCAGGAAGAGTAGTCCGAT
CGCCATGCTGAGTGCCATGTGGTTGCCATAGGTCATGGCTGAATCTACACGCTGCCGGAGCGTCACTGAACGCAGAAGGGTCAATGTTTCCACGTTGCCT
GATCCAGCATCGACCAAAGCCAACGCCTGCGCGCAAACAGCAAGGCATCGCTCGACAGTCGCACGTTCTGTGgctgcagcgacgacattGCTGCTACCAT
GCAGGATCATTGAGGTTGCCGAAGACGAGGCTTTCGTCCTTAATTCACGAAAGTGTAGAACATACTTGCGAAGTGTGGCACGTGCTGGCACATTGCCCGT
ACCAGCGAACCGAAGACCAATACTCATGCACGCTCCCGCGACAATATTTGCATACGATTCGCAGATGGAATGAAGATCCGCGTGTGGAGGCAATCCGTTA
GGATATCCTGTTTGATTAGAGTCTTGCCCAGTATCGCTGGTTTGTGGCTGGATAGACCTATATgcttggagaagctgaacTGGAACTTCGCGCTGCTCGA
TCCATTGTGTTGTCGGAGAGATCTCGTCCCACATTATCAAATTCCTTGCCAGTGTACGCACGAGCAGGATGTCAGGGCGCACGTAGTCCAAAAGAATAAG
GGTGTCTGGAATCTCTAACTGTGCGGCCACTGCCTTGTTGCTCGTGTGCATATACATGAATGCTAGCGCCAGCGCGCTTCCGCAGGCGGTCACACCAATG
TTTACATGCTCACCACCCCCACGCAAGTTACTGCGATCATGTGCATTCTTCGCGTCTCGACCAGCTCCAGGTGAAGCCCCATTACGGTCATTGGATGAAC
CGATCCCTGCTGTGCTGCCGTTTACCCCAGAGCTAAGGCTACCTCCGCTACCAAATGCTTGCCAACGACGCCCACGATAGAGGCAACTTCCTGCCGCATT
GGTGTCCCGATATTGTTGCGCACCACCGATAATATATCGGTGGAGTTTCTCCTCTAACTTTAAGTCAGCTAGTCCGGGGTCTCCCGTTGTAGGGTGCCCA
CGGCCGAGCACAACTAGACCCAAAGCCATGCCTGCTGCTAACGAATAACCTTCCAACTGGTCGAACGAAGCTGTTGACAACCCCGCGTTGTTGTTATTTC
CTACGAATTGTGCGCTCGATGGTGACCGCGCTATCTCGTTGAGCAATAGCTCTGTCATCAATCGGTAGCCACTACCTTGATACAAAATACCGAGCCCCAG
CAAGGCCGCCGTCTGTGTAGACGCGGGTACTGAAAACCCAGCAAATGGTGGCGGCAGTAACGACGGAACGTGAAGGCATAGCATCTTGGAAACCGATCGC
TCTAGCGCCAACCCCAGCCCTGTTCCAAGCAGAGGTGTTTTATCCGATGATGACAACTCTGGGAATCCTGAGAATAGGTGGTCTGTTTCCAACGGTGGCA
GCTCCTCGTGTACATTTTCGCGGGAGGAAGCATGTGTCGATGATTCACTCCGGAGCTTTGCCGCAGCAGTGATTGATGAAGGTTTTCCCGTTGCCGTTTG
TTGTTTCCGCTTGCGTCGACAATGCGCGGCGGTACTGGCCATACCAAGCATGATTGCCACGGTCACGAACTCATTCGATAGCGATAGGTAGTTATATACA
TCGGCCATGGATAAACATTTGAGGTGACCACGTAAGCCGATTCCAAGCAATAATCCTGCGTGAGATGCATACGCTTCTTCAAGATTGCGGCCAGCCGCAT
CTGCTGACGAAGCAGCCGAGGGTTGTCGGCTTCCTGTCGACGTTGCAGGGTTTCTTTGTGGAGTTCCACTTACTGAAGGTCGGTGGTATTTGATCCAATG
GCGATTAATGACCCCGGAAAGGTcatgtgctggaaggcgCAGACCTGTAGCGCACCCGTTGTGAAATTGAGGCCAATACGTCAACTCCTTCGCATAGCCG
GAAAGATCTAGCTCCACGATCGCATTTGTCGGTGGCTTACGACCAGCGAGAGGTATCGCAGGAACTCGCAGTTGCCATACTTGTGTTTGCGCTGCAGACG
CATCAAAGCTTCCGAGGGTGACCATGCCACGCGCCACAGAGAGAGCCATGGATCGTTTACAGAGAAGAAGCAAccgagcttgctgctgctgcgcgtAATC
CATATCCGACAGATCGGGTTGCTTTTCTAGCTTCAGACAGAGAGGGCGGCTGGAACGTAGCAGTCGCGCAACTTCCTTCATTCTCTGGTCCGCAGGAAAC
AGCGGCTGACTTCGAATGATAATTTCTTCCAAGCCGTCACCTTCGTGACTGTCATCGGCATTGTTAGAAGCTATATCTTCTGTTTTATCCGTGGAATCAT
GCTGATTCTGGACGGTGTGCGCGGAATCGACATGGTTGGTTAAATTTCCTGCGCTTGTTATGCTAAGGTCTTCCCGGCCAACAAACGCACAGATGTCGTC
AGTGATATAATGAGGCGGGTGGTGTTTTACGTGGCGAACAGCTTGAGCAATGGGAAAGCTCAAGCCAACCGGTAGGTCATCCAGAGCTAACGTACTCCCG
ATGGGGTCCTGAGTAAGGTAAACCATCAGTTTGCATGCGCTTCGGGCTTGTGAATGGCCAGATTGTGCCGTCGGTAGACAAGGCGAGCTTTCCTTTGGCG
TCGGAAACAACAGCTCATATATTCGGCAGATTGCAAGCGTGCGTTGTAAAGGTTCTTTATGGTGACTGACCATTTCACCAGAactgagctgctgctgccg
atgctgAGGGATATCTAGCAACACAGGAAACTTCCCTTTTTCGTGTGGTTCTGATGCCATGTTATACTTCAGCCATTGAATCAAGTCTGGCACACAGCCG
TAGGCTGCAAAGCAAAGCAGTCCTTCATCTCGAGTCCTCTGCGGCACCTTTGACATGAAAGCTACTCCAGTCTGGCCCTTTATGACACAATTGTCTTGCT
TGTAATAAGCTATGAAGGGGTCCAACCCCAGACGTACAGCTatatccagcagcaagctcgcTAACAGCAGTCGGGGTCGTAATAGCGTGATTGAAAGCTT
GAATTCTTCGCACAACAAATGGAGTCCCGCAAACATATCTTCCATATACTGCTGCATCACAGGGAATGTCGGGTTATCGCCACTTTGGACACCCTTGAAG
CGGCGAGAACAGTAACTACGATTCGAAAGCTGTGTGGGTGGTAGTTCCATAGTAGCAAACAACATCGCATGCTCATACTGGTACAAATCGTGATACTCAC
TCTGACATAACTCACCAAAAGACGAGGAGCAaaaaccagcagcacccaagtcgtcgtcatccatGACTGTTTCAGCTTCAACTGATAACTGACTTTCGTC
TTGACCGCCACAGTATTGCACTAGCAGATCCATTACACAATCACAAAATGACTGCCATTCGCACTCACCACCCACGTAGTCATCGTTTTTTGGCCCACAT
TGGGCTTTTTGCAGTGTTCGACAAGACACTTGTGCTTTAAACTCGGATAAATGCGGAGAAGGGATGATATAATCCAGCACCTCAAATACTTGTTGGAGAA
GAGGAGAGTTCACGAGTTTTAAAGGGTGCTCGCACCGCCAGATCTTGCCGCTCAACGCACCGCATAAATCTGGAAATACGACCTCGTATGCAAAGCCTGC
GTCAATAGAATTCAGTTGAACATTGCCAACGAGGCGAATGATCTCGGAGTTACTTTCAGCTAGAGAATCATCGGAGGTTTCATCCCGCCCCGCACTTGGA
AGTACGATACGACAAAATGGGTGGTGCGCTCGATGAAGTACAAGGGCCCCGTCCTTTTGCAGTACCACAATATCTGCATAATTCCCGCCGTGTTTTTCCT
GACAGCAAGTTTCATGGTTCAATGACCAATTATAGTCCTGTTGACAGATCGGGACGGCATCACGACAATGCAGAACGCGGAAACTACTCGTTTTGTTACT
GCCTTCATCAAAAATTCCCGTTGCAGATTTCCACGTGAGGGGTCTCAAAAGAAGAGTTCCGGTATCTTTGTCCATCATACAGAGCAAAGGAAGACCGTCG
GTGTCTGATGCAATAAATGCCGCCTTTGAAACATCACCAGATGAAGTTAATAATGACGGAATTGGCGAAGGGGTTACTGGAGAAGAACCCAACACAGAAG
GTGGCGAACTAATCGTCGACAGAAATGTCGGCTTTGATGTCGAAGCCCCAAGTCGTGGGGATTTCCACAACGGCGTTGCCAGCCAATCCGGCACGATGCG
CACTCGAAATTCCTCCAGTTCGCTATTTACGCGATACTTTGTCCACGTCAGTCCACCAACCACTCGCACCTGAGGCATCAACGAACCACCTGATGCCATC
GTGGTCATCCGAAACACACAGAAGCGCTGCTCCCACTTATGAAagaccaccagcacaggCGACACATCATTATCCAGCACAGCAACCGCTTCAAAAGCCG
AATTCGCTAGAAATGACTCCACAGGTTTCCCCTTCTGGGTTGGAGCTCCTTCCCCACTTAGCGCCACAGGTTTCACCTCGTCCAGAGGGTGTCTCAATGT
AAAATACCGCGGCCTTGTCGCTTCTCCTGTCGAGCTCGAACTGTAATTATACCTGTCTCCATCACCGCGATTACTTGTACTAGCTCGTCGATTTTTACGA
CTTAAAACCGCCGCTGCAGCGCCTCGAGGGCGTTTGGATGGTGTGCTTGGGATTTGAACAGCAGGACTGCGTTGCAGTAGTAAACCCCGTCCTCTCTCCA
TAGGGAAGAGTCTATTGGCTTGAAAAGGTAGTGCCACTTCAAAtacttctccagctgctgtgtACACATTAAGACAGTCAGAACGCACCAGGACACAGAG
ATGAGGGTGCGTTTGAGGAGTTAACGGCGTCTTCCGCTGTCGTCTGGCGCTTGGAGAGCTTTGAGTGTCATTAGAACTCGATACACTTGGGACGTCCGAC
GCAAAGTCCGCTAGAACGGCGTGCAGAACACGTCCAGGGAACACGAAGCGCCGTTCCACGACATGCGTCCCGCGGTGGATGAACGCCACAGTATCGAAGT
TTACGCGCACCAGGAAGGGAGAATCAGCGTACTGAGATTCGTTGAAGAACACGCGACCACCTTCGGAGACTGCGGAACTGCGTTGATTACTGCGGACGCC
GGCGCAGCGCAGGCGGACGGACGGCAAGTCACATCTAGCCGACGGATCTTCAGTGCGGAAGCGGCTTCCGCACTCCATCGGAAACTTGGCTCACTTTTTA
GCTGAAAGTATTTTGACTACCCGGTATACAATTGCATGTTGACTCTAAAACGTAGCATTTGAGACTGGTTGGCCTGGAAGAGGTGGCGATGTTCGCGCAG
CTCAAGCGTGAGAGTCTGCGCAAGCTGCAAGCGGCGGAGGACAAGAGTCCTAAAGGTTGCATCGATGAACCTATCGTGGATTTGATCAAGACGATTAATG
CAAACCCCAATTACGTACGTTGTATTAGTGTGCTCCAAGGTTGAAATGATACAATGCTGACCTGTTCATACTATTGTAATTGCGTTTCGTGCAATAGGTA
ACGAGTAGTTCGTGCTCTGGTCGGATTGCAGTGTTCTGCGGCGAAGCAGCTACAGGTAATGGTAGCGACCTTATTACCAAGGGTGGCAAGTGGCTGATCG
CTGAGCACGCAACTATCACATTTGACCAATTGGTGGCTGCGTTACGCTCGCCGGATGCTACATCAAGCAGTAGCAATATGGTGCGTGGTGCATACAACGT
TAAGCCGATTCTTTGGATTTTATGTTTGACTTGTGATATTTGTGGTAGATCATTTTCAAACACGAACCGTTCATTATGCACGTCGTGTGTCGTGATCTGG
ACGCTGCGAAGGAACTGCTACAATGGGGCATTGCGTGCGGGTTCCGAGAGTCTGGTGTCGTGCTGGGAAATCGGAAAATCATGTGCGCGATTCGTACGAC
CGCAAACGGATTGGAGATCCCGCTAGGACGGAATGCTGAGCAACTTCTTGTCAACGAAGATTACCTTCGGTGGATCGTGGGTGTCGCAAACCAGAAATTT
GAGGCTAACAAACAAAAGACGGATCGGCTTTTTGACGCCTTCCGCGCCAAGTTTTGCCAACCGGTAGCGAATCAGCAAGCGAGTACCATGGCGCTAGGCC
CATGGAAGGAGTTAGCGTGCAAAGACGATGTCAAGTTAGTAGGGCATACGGCTTTGCAGTACGGTGATAGCATTGTCATATTTGGCGGTCAGGGACCAAC
TGCATCAGGAACTACGACGCGCGTCGCTGATGTGAACTTCTTTACTCCTTCCAATGACGGCTCGCTTCAACAGACGTACAAGGCAGCGGCTGGCACTACT
GGTCCATCGGCCCGGATGTACCATTCGGCCACTGTGGTGGGGAATCAAATGATCGTATTCGGTGGGCGTGCTAGCCCTGCGAAACCTCTGAGTGATCTGT
TTGCGTTCAACCTAGATACGAAGCAGTGGGAGAAGCTTGCTCCttgtggagaagttggcCCCTCTCCGCGTTGGAAGCACTGCAGTTGTGCTGGTGGGTA
TTTCGTGGGACATTTTTCTCGGTTGGAGTATTATCAGCGACTAATTCTTGTTTTGCGTGTTGCAGTTGGATCCGTAATGTATGTCTACGGAGGCCGAAAC
GAAAAGCAAGTGTTTGGCGATTTATTTGCGCTGGACTTTGCCCATAACCCTCCCCAATGGCGTCAGATCGGTGCGTTCATttgcattgttgctgcagctc
gattTTTTTACGGCGCTACAGGTCTTCGAGTGAACCTAACATTTGGATTCTGTCATGTGCATATTCAGAGAACTCCAGCGTTCTACCCCGATTTGATCAC
ATTGGCGCGGTCATCAATTCAACTAAACTTGCCTTTTGGGGAGGCTTGGCAACGCTAGACAGTATCGATGGCAACGATGAGGTCAGCAGAGAGAACGACT
GTAGAACGTGTTTGCTGTTTGACACAGCTGGAGAGGCGTGGGAACACAAAAAAATGGTGAACTCCGTAAGCATAGGTCAACCTCCTGCTCTTTTTGCTAG
TAGTGCCAGCCCTGTCAGTGACTACCAAGTTATTGTTGTCGGCGGCACAACTCCTGCCCTGCTTACGAATGGAGACAAGGCGACCCAAAAGGTGTATTTG
GTGGATATTAACACATCGCAATGGACAGAGCTCGGTGAAGTGAAGAGCTCgaatgcagcatttgtggGACATACTAGTACGTGGATGCCAAGCAACAACT
CCGTCTACGTCTTGGGTGGAGGTTTCCAATGCTTTGGTTTCGGTCAATTCTATTCGTCACCGTACCAGTGCCCCCTGACATTTACATCGCTGAAGGAAGT
CACAACCGCCGCTGCCAAGAGCAGTGCGGTTAGTCTATCGTCTGCAACTTCTCAACCCAGTCGTCAGAGCGATAAACCGCTTGGCGTTCTCGTCGGGAAA
CTCCaagtgaagaaggtgaaaaCATTGCTCGAGAAAGCACACACGTACGACAAGACGCGCCGCGTCCACATCGCTAATGCTGCTCAATCAAGCACTCCTA
CTGGCGATGGGAAACCTACAACTTTTCTTCTCCCTGTCACGTCGGTGATTTATGAGCTCCTCGAGTCGACAAGCGATGCTGTACTAAAGCAGCTTGAGGT
TGTACCTGATGATGATGCTTATGCAAACAAGTTCGGCAAGATCAGCGGGCTGAACCGCAACGAGGTGATCTACAGTACAATCAGCGCAATTGCCAGCAAG
TACCAGCTTCCTGCTGACATTGAGAAGACGATTCCTGAGAAATATGAATTTGTGAGCGATGTCTTGCTGATTCCCCGCGACTCCTTCCTGGAGCCGGAAT
GGGCACCGTTTGCACAGGAGATGTGGGTTCAGGTATGTGAGGCCACTACCCCCGTATTTTCTCGTGTCGCGCGGAAGGCGTTTATCGACTCGAACGAGAA
GCGCCAAAGTCATGTGGAGCTTTTGTACACTAACCACAAAGCTCTTACGTCCCACCGCAGCAAAGAGAGCCCAGGCTGGGTTGAAATTCGTGAAAACAGC
ATTATCTACGGCTGGGATCTCACACGGGTCATGTTCTCATCTGGTAACGTCACAGAGAAGGCTCGTATGGCAACCATCGGTTGTCGTGGGGAGACCATTG
TCGACCTCTTCTGTGGCATCGGCTATTATGTGCTACCTTTCCTTGTGCATGGTGGGGCGGCATTTGTCCACGCTTGCGAATGGAACCCGGACTCGGTGGC
GGCGCTCCGTTTCAATTTGGAGCGTAACCACGTTGCTGACAGGTGTAAGGTGTATCTCGGGGATAATCGAGAAACTGCACCTACGattggcgctgttgct
gaccGCGTGAATCTGGGGCTTTTGCCCACGAGCGAGAAGGCCTGGCCGTTGGCGGTGCAAGTGCTAAAACCCAGCGGTGGATGGTTCCATGTCCACGATA
ATGTGGCTGTCGAAGATCGTAAAGCGTGGGAACAGCGTTTGGTGGACACTTTGAACCAGTTTGCTCAGCAGTTTGGAAAGCACTGGACCATCACTTGTGA
GCacgtggagaaggtgaaATCCTACGCACCTAAAGTGTATCATCTCGTAGCTGATATTCACTGCGTGCCGATTTCACCAGCCTAAACCATATCAATTCAG
AGAAGCACATCATTTTACCTTGCCCTCCTTATTCATAATTGCACACCGAGTGTCAGAGAGCTTCTGTTTATACCAAATGCAAAACGTCCTTACTCCAGGT
AGCACTAAACAACATCAATAACGCCGGTGTGCTGCTCGATCGATGTGAAGACTACTCACTTCGTTCCCGTGCGTTTCGTGCCCTCCACCATATCTCGGAC
ACGGTCGGTACGGAGAAGATTAACCAGCTCTTGGCGCGTGGGCACTTCATAGTTGAACAAGCCTCTGAAGTTCGGGTTTTCAATGGCGTGTGGCGGTAAC
CCCGCGGAGTAAAATGCCGCTGCCACAAGAAGGAAATTATCTTTTCTCTCCTCTGGAGTGCACTCCACAAGCGACCGACTACGTCGAGGTGGTGACGGTG
ACGTCCTGCGCCGTTTAGTTGGAGGGGGTGAGGCCGTCAAGGCTTCCCGTTCACGTTCGGAAGGGGCTTGAGCTGCTACAGACTGTTTCGGTCTCTCTTG
CAGTCTCTCGGCTTTCTTGATCCGTCGTTCTTCATCTAGTTGGAGGTATTTCGTCTTGGATTCTTTCGGAAGCTCGGGGCATTCAAGTGTGTGGGCTAAG
ACATTCCCAGACGGTTGGGCATTCTTGAGGACTGTATGGCAATACTTACACTCCACGTCTGGATGGGGCTTGGTGCCCGATTTCGGCACGACagtcttga
agagctcccAGATCTCGAGCTTACGTCTACCCATTCTCCGAAAAACACGATCTTGTTTTGTCGCGATGCTAATTTGAATAGAAGAAAAAAGCGCGATCTT
TTTCGCGCCTAAATTTTCAAATACACATTACTTACTGAAAACAAGATAAACGTTCCTCAAAGACAATACGTTTTAAATCACCATTCGGCGTTCTGCGTCC
CCCCATTTCGCAAATCTCAAATCGACGCAAAAATGGCTCAACGCTTTCAGCCGTCAGAGGTGCTATCCAAGAAGCGATTCAACGCGCCATTTGTGCAGCG
TCGAGGAGATGGCTTCACAGAGTTCGAGGCCATGGGGATGGTGCAGCTAGTGCGCACTCGTTGGCGCGAAGGTTGGGACGTCATCGCCCAATTACACAAC
GACCAGCATCCAGGCCACAGTCGCTCAGGAGATTCTCTTAAAAAAAAATTCTCGAGACTGTATCGAGCCAATGTGCCGCCTCGTGGGGCCAAAAACCACT
CAGTTGTTATGTTGGCGCATCAGGTTCACAGGGAGATGATCGACGGTGTGACGATTACACCCGAggaggcggcagcagcagaagcagaagcagaagcaga
agcagaagcagaagcagaagcagatgcagaagcagatgcagaagcagaagaagccGAGAAACAAGAAGACCAGGACGAGTCCTTCCAGACTGAAGAGGCC
CCAGAGTCGGAGCACAGCTGGGCAGAAACTCCACCGGaggttgcagcagcatcgacaccAGTGTCTGCCCCAGCTCcggttgttgctgcggctACTCCGG
TGTCGGTGGTGCCGCGCTCACGGGTGGCTCATCGGGCTGAGTGGAAGATACCAGTGACCCGGACAGATGTagctgttgctcctgcagttTCTACTACACT
TGAGTCGACCGACGACTTGTTGATGTCGGTGTTAAAAGTGATTCTCacgtcacagcagcaacgtgacTTGGATCGGGAAGAAAACCAGCTGAGGTGGGAC
GAGGAACGGAAACACCGTAAAAAAGAAATGGAGCAGTGGAGACAAGAGATGGATCGTCGACGTGCTGAAGATCGCGAAGAACGTGCCGAGAGTCGACGCA
GGCATgaggagatgatgcagatgatgatggtaCTGGCGGGCAAAAATGGCTCGGGACAGCAACGGAACGCCGAGTGCTAAGTGAACATTTGGGCTTCGGT
GCTGTTTTCGTTTAGTAGACGACACCTACTTATCTGTTTACTGCACTCAAGACAGGTTGCAGAGTGACACCGCTCAAAGGGTAGTTTACGGATCGTTCAT
AATGGAATGGGAGTCATAGGTACGGCATCTCGCGGAGTTGAATTTCAAAACATGTCCTCATCATGCTCGAAGCTAGTTTTCTGACACTCGCTTGCTCCCA
TGACAAATCCAGCACCATACATAGAGTCCGTTGGTGGTAGCATGACCTCCATTCTCCTCCAAGGCAATCGAGAAATGATGGATCGAAATTCCTCGGCCCT
TCAGCCCATTGGTAAGACCTACATATCTAGTCGCGAGAGTGGCACCGAGGTACGATCCGATGCTCATTATGGCATTTTAGCGCGCGATGTCTTCATGCAG
CTCATATCCGTTGCTACAATCAAGATAGTGGTTTAAAAGTAGCATTTTAGCATTGGAAATGGCAGTTATTTTAGAGATTTTTCGTACCTATAGCTAGCGA
TGTGGCATCGCTGGCGGATGCTGAGCATGCGAAGCGCACGCGCTTGGCGACGGGCGAGTGCTTATCGACTTCCAGTCGCGAGTGCTTCACTCCAGTGTCC
GTTGGCGCCATTTTTGCCTCTGAAATTCAGAATTCAAACCATAAAATTCCCCACCTGACGATGTCTTCCACCCTCAATGTGAGCACAAACCCCTTGAGCT
CGGAGAAGCTCTGAAATTTAGAGCAAACTTACAACATGCTCGTTGTCGTGAAATCCTCAATTGTTGAGCATCTGCTGCCTTTTAGTGTGCGGGGCCGTAG
CGATACAATCGCTACTTTCGCTACGCATCAGGACAATTGGTACTGGAAGTTGGTAAAAAGAAGACGCTCACAGTTTACAGATTTAGCAATAACTTTGGAT
GGGGCTGCGTCATCAATGTGCTGCACACTAACCTGAGTAGCTTTTGTGAGTAAATGCAATGCTCATGACACACACCTCAGCTTGGCAAATCTGCCACACC
ATATAGTGGTCAATTATTCTGTGGGTCATTCAAATTACACAATAAACTACTCGCTAACAAATAAAACCCACTGGAGTTTATGCCATACAAAAGTTTGTAC
AGTCTCACCCAGTTCCTTCAAGCAACATTCACCGGTGATTTGACACAAGTAGCATTCACTGTTGTTTTCATTATCCACCGGATATTTATTTCTATGAGCC
TGTTTTTCAAGTTTCTATAAAAATGGTTAAATACTATACTTTATTTTAAAATATGTTTTAAACCAAAAAGCAATAATACTTATTAGGGTAGGGTTCTCAA
AAAGATGACCATTTATTACATGTGCTGCAAATTCTTTTAGATTTTTCAAAAAAGAGTAGCATCTAATTTTTTTTGGGTCTGTACTTAAACGACAATTTTT
TGAACTGAATGACCTCAGCAGAAACTCTGAATTAAAATCCAGAGGACTACAAAATTTAGAATGCTTTTATGTTGAGTCTTTTCAGTTCTGATAACGAAGT
CCTTATTATAAaggcactgagaatgtccacatttcctatttgttttggaaagtgtagaattcaatgagagctcaagctgctcgcAATGtctgtttccgcc
ttcgatccaatgtaatgggtaTGGTCGCcccattacaaaggccaacttctggaacagggacgtcaacgcagcgaggaacatgctgggACTGCTCAAAGGC
GAACTgaagcacggagcgagaTGGCTGAGAGCAATTCagcgaggtcagtagcgcaagaaacgtaaacagaaaaaaaaagtggctggaaagactcgcagcg
tacgtgttgcgggaatgcatagccagccacatccatatattcaggcatagggaccatTAGGACATTATCAATGCCACCAGCAATAGTGTGCGTATCTTCT
GAATGACAAATGTACTCTACCAGAACAAGCATCAGACATCATGCTCTCGCAAGTTCAGCACCTCGCCTGCAAACATCTTGTACCACCTCCATGCCTCCCA
CATCTGCATTTCGATCGGGCACGTTGACGCATCTTGGTTGCGAACACCTTGTGCTTCCACCATGCGCACAATATTTGCCTTTGAAACGAGCAGGCTTTTC
GTAGCCTGCTCGCGAACACCTAGTGCCTCCGTCGTGCGAGCAATATTTACCGTTGGGGCGGCAAAGTTTTTGCAACTTAACCATGAGCGAACAGGACATC
CAGCCGGAGTGCTACCCTCAGTTAGAACCGCACGCTTGGTAGAAGTCTTCATTTTCCGCCCACTGCATTTTCGTTTGTGAGTCGCCACGGCGCCAATAGC
AGGTGAGTATCCGCCCCGCCCCGCACCAACGCCGCCATCGATCCTCCACCGTTTTTGCGTTCAAAATTTGATGCGATTGGTATCACAATGACCGCCGAGG
AGATAGAAATTCTATAGCACTGTCAAGTACGAATGCATTCTTGTCACATTCAGTAGGCCCGTCTTCTAATTCCTTGATGGCTTTGCTGCAGTAATCGTCT
CCCAGAACCTGCGTTTCACTTGAGATTAACTGTTGAATTATGGCATCTACTTCGGCTTGCCAAACTTTGGCTCGACTGGGTGTGGATTTCGTCTCTACAT
GGCACTCTGTGCACCTGTCGGATCAATCAGAGCCCTTGTGAACTTTTTCTGACGCATGGActctggaagcagcttcgactACTTCAACAGTACCAAAACT
TCGCACAACAGAGCATTAACAAGGGTCAAAGCCCTCATAGTAACCTTCCGCTTCACCATCACCACTATTGACACCAAAATGCTAGCTTTCCGGAACTTCT
GTGAAGACAAACTCGGCTCCTCACGGCAGATACCAAATAGCATAAGTTAAAGTGGTGATATGAAGCGTTTGTGGATTGTCCGGATTTTAGCGATTATTGC
ATCCAATTTACTCTATCAAAACCCAGAGCTTCCCCGTGTATATCATGGCATAGCTAGCTCGATTGTGGCAGAGTGATTCTATGTTTGTCTGTTGCATCCT
GACGGTGAGCTCTTATCCATTTTGCTGCAATCGTTAACTGTGTCAAGGTTGAGGTCATTAATGATTAAATGAAACAGACATGTCGTAGCTAGTTGATGCG
TGGTGCCAGGTAAAGTATCAAACATTGATGATAACACCTAGGTTGACGATGGAATCCATCCCAAATGTCAATTCACAATGCAATGCAGGCGATCCGAATA
CCACTACTACTGAATAAAAGATCATCATAACCAACCACGATACGATAAGCAGCTGTTTGTGCACGCGTAGTTTCTGTCTGTACGCTCAGATCTCATCATC
TCGACCGTGCAGTCGGCTGCCAGCAATCTTTGCCAACATTG