Description :
From Genome Similarity Track
Location :
Scaffold_355:14002- 19162
Transcript NameFunction/comments
Phyag_g4975hypothetical protein

Sequence
5160 bases(100 bases per row)
GCGCTGAATCTGCAGAGTGTTGATGTGACTAAAGTGGTGCAGGAGGGGGCGCCGTTGTTACGTAGTGGAGGAGAGGTGGGTGAAGGGTGTTGATAAAATG
TGGGTGTGGAGCTGACGAGGAGATTTTTTGATGGTAGGAGTATCAATACTCGACGAATctgacggacgaggagcggCGGGTTCATGTGGTGAAGCaacgt
cgactgctgctgagacgCCTCAGTGGAGCGGGGGGACCCATTTGGAAAACACGCGAGGATTCACTGaccaagcagcttcttccgaGACTTAACCGAGACC
GTACGTGAGGTTGTTGTGGGGGTATTTAGGGGCTGTCTGACTGTAACTTTTGTAGATGCACAGGAAATTGCGGATGATATTGAGGCTAGTGAAGAGCAGA
ATGGTGGTGGTGAGGAGTCTACTGCGGCTACTGAACGAAAACAGGCTAGCGAGATGTTGTCGATCCCAGCAAGGTCGAAACGACGGCGGATTGACGCGGA
TGAACAGGAGAGTGGCGAGAAACGGATGAAAGTTGATCATCaaggcgatgacgacgcgATTATGGATTCTGAGGGTGGGCATGGATCGGTGATTGAGTCG
CGCGCGCAGACGAAAGCGACGATTGTTGCGGGCTTGGTCTCTGATCTGTTTGAAAGTATGTTTGATTCCAAGTGGGAAGTTCGTCACGGCGCACTTTTGT
CGCTGCGGCAGATTCTTTTATCAGGACATTTTACCGGAGCTGTTGAGGCAGCTCACCAGCGAACCTTTGTTGACAAGTGGCTGGAAGAATGTTTGATTCG
ATGCATCTGCGTACTAGCTCTGGATCAATTTGTGGACTACTCGGCTGACGGGTCGATCTCTCCTGTACGTGAGGTGTGCGCACAAGTTTTTGGTATTTTG
CTTGGCAGCCTCTCTAGCGAAGACACATTGGTTGGATACTTGCAAGTCGTGCGTACGCTGTTCAGTGGGTCGACATGGCAGGCATGCCACGGTGGTCTTT
TGGGGCTGAAATATCTTGTCCGAGCTCATAGCAGTCACGCTCAAGTGCTGGTTCTCCTCTTTTTTGACGATGTTATGACGGCGTTTGCACAGACCGAttc
agaagaagacgttcAAGTTCTGGCCGCCAATATGTTCAAAGATTTTGTGTCATTTTTGGATCGAGTCGAGCATGCAAAGATTACGAAGGCTGCTTTATTG
CTCTGGGGGTCTCTGACGGCTCGTGGGCAGACTGGTATGGCTACCGCAAGCATAGTCCAAACGCTAAGTGCGTGGTATAACCACTCGGAAGTTGCAGCAC
TATTACAGAGTGATGATGCTGTCAGGACTGTTATCGGGGAGAAGCTATCATACACAGTCCCGATGCTCCACCATCATTCGCAGTCCGTCCGGGGGTCAAG
TGCTACGTGCATCGCAGCCATTTTTTCCGGAGAGTTTTCCTTGTCAAATTCCAGCCCGGCCAATTTCGCTCGAGTTTTTCTGCCACACTTGCTCTTTCAG
TCGCTTTTGGAGACGGATCGTTCTGTCCAGCGAAGCTTGCTTGCCGCGTGGAAAAATGTAGTTAGCAGCCTCTCGAAAGACAAATTGTTGATGTCTGTTG
TTGGTGAAGAATTGCCGAcgtggatgaagctgctgtggtcTACGAACCAGATTAATTCTCTAAATGTTGAAATGGCTAATCCAGACGGTACTGTATCCGG
TGCAAGTGTAAGTAGTTCCGCGGATCGAGTAGCACGAGAGAACATGTCGTCCCGTGTGGTGTTTGCGGAGATGattggttttgctgttgcgCACATCCCT
CTTTCCAGCGTTTGTATGACCGAAGTGGTCCAGATAGTTCGCGAGGCTGTGTGCGGTAGCTGCGGTGAACGACAGTGTGGTgctttgctggtgttgtCAA
AATGGGGATTCTTTGAGAAGCAGTTGAAACGCGAAAACTTGGACGATCAGTCGAGACGAGTCCAGTATTTACAAAATTCAATAGCGTCGTTGCTGGGGTC
TTTTGCCAATAATCAGTGGAGGACACTTGAGCCTGGTGCATCGAGTGACAAGAGACCAGTATTTTACAGCGAGCAACTTGGATCACTGGCGCGCGTGGCA
CAGATGGAAGCTCGAATTATTGACATCTTCGCCTCCGTAGGCATTTCAGTTcaaccagcaccaaaacCAAACTCAACGTCTGCCGCAGATATCTCACGAC
AGATCGCGGAGCACATAGCTCTATTCCCGTACGACAAATTGCAAAGTCACCCGAAAGAATTTGAAATGGCTCATTTTAAGAGGCAGGacctcttcctcgt
ggatGAACTTGTCCAACAAAGCTTCTCTCGTTTTTATCACCGGATACAAGGTTTGGGAAGCGGTGCGTACTGCGAAGTATTGCCTGTTCCCAAAAAGAGT
GGCTTTCTTGTTAAAGCATTGATGAATTCGAtcaaggaggaagaagaaccagcatTTCGCGGTATGTCGGCCCGAGCAGTAGCAAACTTTGTAATGAGTC
AGGCTCACGTTCAGAAGAAGTGTGTTGCAAAGATCATTTCCAACCTCTACAACAGCGCCGCAGCATTGGTAGGAGTATCTGGTGGTCCTTTTGACGACAT
ATTGGGATGCAGTAGTTCGCAGGACGACCGCGGTGCTTCAGTTTCTTCTGATGTTTTCAAGAAGACAAAGGTTCGTGTTGTCGGggctgaagctgcgctg
CGTGAAATTTGTAATTGTGCTGGAGATGCTCTCTTCGATACATGTCCTGCAGTGGAGGATGTCATTTCTAAGGCTTGGAGCCAACCAAGCGTTGACGATT
CCACTATTCAACGATGTACGTACTTAATCGTACTGGTGATGCCTCATGTAACGAGTAAAGCCATGGAAACTTGTTTGTCGTGGGTTGGCCGACTTGCTCA
AATGACTCAACAGCCGTATGAAGACCATCAAACACGACGCATTGTAGCTCATGCGATAGCTACCATTTGTAAGCACGCGCAGGGGCAGCATCGTGAAAAC
GCGATGCTCAGTGTGTACCAAACTATCTTCGTGGCATTCTCAGATGCTAGCAACACAGACGCACTTGAAGGTGCAGTGATGGTCCTCGATCGTGTCGTCC
ATACACTAGGAGCTGATCTGACACCATACGTACCGAGTCTCGTTCATTTCGCGATGCAGACTATGAGCTCTCAGACAAAACTTGTTCGTActctcgctgc
tggggcGTTTGCGGACATAGTTCCGTTGATTCCGCTTCAAATGGATCTCGAGCTTCGTTACTCGGATCAGGTACTTCCCGACTCGCTGAAAACGATTGTG
AACCAGAACGCAGTTTCGCGTAGCTTCCTGGAGAGCTTCACGGAAGGGAAGGCTATTCAACCTACCGACGTTAAATCTTGGCTAGCGACAGAGACAGCGT
TACGCGAATATCAACAGCATGGTGTGGACTGGTTATGCttcatggccaagaacaGCCTTCATGGTATTCTCGCTGATGATATGGGTCTCGGAAAAACGTT
GCAGACGCTGTCGGCCATGGCTGCAACGCTAGCAAATTCATTGTCAATCGGAAGCAACGGGGCCGCGATGCCTTGTCTAATTGTATGCCCGCCGATTATC
GTCCACCACTGGATCCAGGAGGCCAAGAGATACATTCCAGAATTCTTTGCGTCCATCGTCGACTATTCATTATCAGCAAGTGAGCGAAAGGCTCTGAATC
TCGGCACAGGTATCCCGGCATCGAATTGTGGCCCGACATTGATCGTGACGACGTACTCAATTTTGCGTTCAGATGTCGAGTGTTTGAGTACGATCGACTA
CAGTTTtgtggtgctggatgaagcacATTTGATTCGGAACCCATCCACGGCACTATTTCGTGCAGTGTTGGAGCTCCGCGCATTACATCGTGTTGCGTTG
AGCGGAACACCGTTACAGAATAACGTCACCGATTTGTGGGCTCTGTTTGAGTTCATGATGCCAGGATACTTAGGCGATTTCGCCGTATTTCGTCGCGAGT
TTGTTCTTCCAATCACGAGGTCGAAAGAGCGAAACGCGACACCAAAGCAGAAGGAACTGGCAGCGATTGCTATCGCAAAACTACATCAAAAAGTGCTGCC
GTTTATCCTACGCCGCACAAAAGACGAGGTGTTGGAAGAACTTCCACCGAAAATCATTTCGAACGTGCTGTTGCCGCTCTCACCACTTCAGAAGAGGCTT
TATTCGTTAGCATCGTCAATTGAGAATGATACGACGAAGACAAAAGCTCACAACACGAATACCGGAACGAAACCACTGACGAACGTATTGACGAATCTCC
AGTTACTCCGCAAGATTTGCGTACACCCAGCGCTTGTTGCAGACAACGCAATTTCCGGACGCCTCAATGCCAAGGAGAAGCGGATTCTCTGCGACTGGAA
GAGCTCTGGAAAAATGACCGGTTTGCGCGATTTATTGGTAGAATGTTGCGATATCGCAGCGGGCGATCAAGGAAGTCGACAAAGTTCTGATGTCGACAAC
TTGGATGACGCCGATCTTTCTCCCCACCGCTGTCTGGTGTTTGCTCATCTGCAGAAAACACTAGATCTCACagagcaaatgctgcaagaCGCTCTAACTG
GAGTATCGTATCGGCGCCTGGATGGACAAACGCCGCATGCTAAGCGCGCAGATAttgtgcagctcttcaatgcCGATCCGTCGATTGACGTCTTGTTGCT
GACAACTTCAGTTGGCGGTTTAGGACTGACCCTTACCGGCGCCGACACTGTAATCTTCCTCGAGCACTCGTGGAACCCCTTTGTCGATCTGCAGGCGATG
GATCGTGCACATCGGATTGGACAGAAGCGAACCGTTCGCGTGTTTCGCTTGATCATGGAGGAATCCCTCGAGGAGCACATTCTAAATCTCCAGGAATTCA
AAGAGCAGGTTGCGGCTACGGTGGTCCAGAAGAGTGACGCCCAGAGCAGCATGAACACGAATACGAAAGGAGTCCTCAATTTGTTGCAAGCATCCTCGAC
TGCGGTGGCTGCTAAGGAGCTTCGAGGGGTTGTCGCGACAAAGCAACCTGGTGATGATGGTCAGTATGCTGCAGGCGCACTTCCACAAGGAGCCCAAGAA
TTGCTCGACCAAATTGGTGAGCTATGGGATGAGTCGCAATACGAATCGCTAGCTTTTCCA