Description :
From Genome Similarity Track
Location :
Scaffold_136:14002- 15923
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_136-snap-gene-0.9Cleavage induced predicted protein

Sequence
1921 bases(100 bases per row)
TATGGTGTGTTTGGCGGCGCGATTGCATTTCTCCTCGGTCGCGAAAGCCCAGCGTCGCTCGAGCCAAGACTCGAGACCGATGACTCGCGATTCTTCTCTT
ACGTCTGGGTCGACGACCACGNNNNNNNNNNGGGCTCGAGATCGATGACTCGCGATTCTTCTCGTACGTCTGGGTCGACGACCACGTTATGATCGAACCA
GACGTGGGTCAACGCTTGCACCTGGCCAGCCAGGCATTGCGTCTGGCGATGTTGGCAGTCCTTGGGCCCAAGGCCATCAACGAGAAGAAGTTCTCTCCAT
GGGAGACGCGTCTGCAAGCCCTCGGACTCGTCTGGGATACGACGACACGGACGGTGTCAATGCCGCAAGATAAAGTGGACAAGGCCATCAGCAGGATTCA
AGAGGCGCTCGCCGCACATTACGTATCGAAGCTCCAGCTCGCACAACTGCTAGGTTCATTGCGTCATGTCAGCACATGCATTCGAGCAACTCGCGCCTTT
CTGCAGCGTCTCCACTCGACCTGGCTCAACGCCCGAGCTCACAGCCGCGTCCGACTCGCACACCACACCCGCCTAGATCTACAATGGGTCGTAGCGCTAT
TACGCGGAGGGTCGGCGAACGAGGTACCGACGAGCATTGTGGCAGGAACATCGCAACCGCAGGTGCATCTCTTCATGGACGCAAGTGATCACGGCCTTTG
TGTCCTCTACCCTGCGGCGAAAGAGTTCGTCCGCGTTCAATTCGGTGCCGACGAACGGATCGCCATCAGCAAGGGTGCCGCAGACTTCAGCATCAACGTG
CGCGAGTCACTCAGTGTGGCAGTCGCGGCAATCGTGTGGGGCCCACAGTGGAAGGCATTGGCGCAACGTGATCCGATTCACATTCGCTGCTGGATCGACA
ACGCATCCGCGGTCGCATGGATGGACCGGCATCAGTCAAAAAACGCCGCGGAGCAAGAACTCATCCGCGTCGTGTCGTGTGCCGAGGTCCAGTTCAACAT
CCACTTCTCAACGGCTCATCTGGCTGGCGCGGCAAACATCATGGCGGATCGTGGCTCTCGTGCATGGTATGGCAAATCGCTCACCCAGTGGACTAACGAT
ATGCTTACCTGGTCTGAACAGACTCTCCCCGCCGAATTCCGCAAGATCTACAGCAAACCATTGTCTCGCTCCAATGGAAGTCGCTCGCCGACACGTCCCA
CCGTGTCTACCTCAACACCTGGCGTCAGTGGTGCGAGTTCTGTACACGGCACGGCTTCAACCGATGGCTACCTGCCGATGATCCAGTCTCTCAATCCGTA
CAGCTCACTGTGTTCGCGGTTCGCTGCTGGCGTTCGGACCTCTCGGCAACGCCTCTTCGATTTGAAACCATACGCGCTAAGCTCAGCCACGTCGCATGGT
GTCATCAACTTGTCCGCGGATTCCGGCCACAACTACTGCCCCAGCATCAACTCGCATTCAACGGTATGCAGCGGCTCAGCCCACCTCAGCGCCGACGAGG
AGCCGTTAGTACCAAGATGCTCCAGACCATCGCCGGCTCGCTCGACCTCTCCATCCCCCAGCACCGCGTCATTTGTGGGGCTGCGGTGCTGGGCTTCTTC
TTTTGTTTGAGAGGCTCGGAGTTCCTCTCATCCAACGGCCGTCGCCACGCCTACTGTATTACGACATCTGACGTGAAGGTCATGGATGCGCTCGGGATGG
ACACGATGAGCTACCGACGAGCCGCGGTCGTGCGAATCACCATCAAGGCCAGCAAGACAGACCAACAAGGGCGATCGACAACCAGGGAGCTACTCAAGGG
CTCCCAGCCTCCGGTATGTCCAGTGTTTGCTGCACTCCTGCTGCTCAAGACCGCACAAGCCGTGGACAAGCGTCACGGGACTCCTCTGTGCTCCATCAAC
GCACACCAAGTGCTCTCCACG