Description :
From Genome Similarity Track
Location :
Scaffold_860:14002- 15387
Transcript NameFunction/comments
Phypl_g11330hypothetical protein PHYSODRAFT_470960

Sequence
1385 bases(100 bases per row)
GTTCATTCTACAATCTGCCGAACGGTACCAACGCCAACTCTTCCTGGCCTCGCCATAGAGTATTTTCTCTTTCGAAACCAACCATGCGACTTCACTACAT
CCTGCTGATGGTTGTGGCTACTCTTGCTGCAAGCAATGCCGTAGTCTCGGCGGTTAGTGTCAAGAAACTCTGGAAGACCGACTCGATCCAATCCATTAAC
ACCGCCCAAGCAGAGACCAGAAGTAATCGATTTCTGCGTACTGGTGACACAAATAATGCTGTCTACGTCTACAACCCGGATAAGCGCGACGGGCAGCGCC
CGGTCTTCATTGAGCACAAACTTCAGAAGGCGCTGACGAACCCGAAGAAAACGAACAAGCTATACGAGCAATGGTACAAAAGTGGATACTCGGCGAAAAG
AGTCGCCGGTGGCTTGAACCAGGATGAGAACAGAGAGCTAGACGAGGTTTACAAATCGCTCGCTCGGGGGTACGCGGCGTATATCAAGGAGAAGCGTTCT
TGAACCTCAGACGCTGCATAGAGGATTTAATTATCAGTTTCAGTAGTTCATGTCTTACCCATTGGTAGGTAATTCTAGTTGACTACAAATTACTTCAGTG
AATTTAGTGGTAGTGATATTTTGAGTTTGGTTGATGCCACACTTGCGTGGGAGGGGAGACAACGATTAACGCAGGCAGCACCAATTGAAAGTATTTTATG
ACTTAGTTCAGTCGATGGTAAGCGGATTACCATCGACGGTTGATGGACGTCAACCGAATCATTTGTGTTTACAAAAGTCAAACAGCATCCGTTCCTCGTC
ACTTAGTTCTCCTCCAAACCGACTGACGTCGTAGATCTTCAAACTGATTCGTTTGGAGCTGAATTACGTTAAATTATCTagaagctgctcgtgtgAATGG
CAATCACCGTCGTAAGTTTGCACTGCTGGACATACTCCGCGTTCAGTATTTTCAAGAATTACGAGGCTGGAACAGAAGCCAAACTCTGCAGACACTGCAC
CCGACACCTATATAGCTGGTTAAACTTGACAGGAGGGGTGTGGTGGCAGCGCTAGTGCGTCGTCTAGCATCAGAAACGGTTCTGGATGGTGGCACTGCTA
CAGATACCTAGCAATGGTTCAGCTAAACAGCTTGGATTCTTCATTGTCCCGTGAGTAAGCATCAACATCAACTGGTAGAGTAAGCGAACTATACGAAGAC
TATAAATTTGTTCTAGCTGAGGTTGTGAGGCTTGTTTTGTCTTGACGCGCGATAACTGTACCTCTAGCAGCAAAATCTTCAGACTGTGGTAATGGTACAT
TAATATACTAGCGCCTTTACGTGGATGTAAACGTCGGGAGCTAGTTACTGGGGATTCGACAGCCGAGTGCGGGTGGCAGTAGAGG