Description :
From Genome Similarity Track
Location :
Scaffold_12:140017- 141333
Sequence
1316 bases(100 bases per row)
TGCATTTATGCGCAGCCGATTGCGAAGTCACTGTCGTCACAGACTTGTGGAATGATCTGTCTTGATCTGCAATCGCCAAAACAGGCGATCGTATCAAGAT
CTGCTTGATACCTTCGAAGGAGCGCTGACAATCAGCACTCCATACCCAATTCTTGTTCGTTATCGATAAACGAGAGAGATGAACAGTCATCTCGGCATAA
ATGCGTAAATATTTATGTAAATACACCACTAGGCCAAGGCAATTTCGAAGTCCCTTGACATATGTAGGCACCGGCCAGTCGGTGATCGCCTTGATATTTT
CTGTATCGGGGCGGACGCCATGCTTGCCCACGATGCAACCAAGAAGTGGTATTTTGCTAGCAGCAAATATATACTTCGTGAAGTTGGCGTACAACTTATG
CTCGCGCATTAGTGTAAAACCCTTCTGGACGTGGAGTCGGTGCACTTCCACATCCGTCTGCCCGTCCATAGCCCAGATATGAACGAACACATCATCAAAG
TAGCTGGGTGCGAACTCTCTTACGAATCTTAACCGATTCGTCACACATCTTTTGAATGTGGCAGGAGCATTACTCAGCCCTTGTGGCATAACCAGCCCCT
CACAGAGAATACCACTTGGGGTGCTCACCGCTGTGTACGGGATGTCAATTTCACTCACAAGGATCTGATAGAACCTGTCCATCATATATATCGATGAAAA
GATGGAACTCTTTGACATATCATCTATATTGACATCATTCCTTGGTATCGGCGTTTGAGCCGGTACAGTTGCAGCATTAAACTTATTGAAAGCATGTACT
ACCCGCCAACCTCCTGTATCCTTTCACATACACAAGGTCAGAAAGCTATGTGGAGAGGTGGACTCCCTCACATGGCCGGCTGCTAAGCTATCTGCAAAGA
ATTCGTCGATCGCTAGTACTTGTTCATGAGGCGGTGGCCCCATTGCTTCATGACACAGTACTTCGAACCCGGTTTCAGGTCGATTTCGTGACGAGAACCT
TCGCCCTTAGGTAACTCGCACGGCACTGTTTCTGGGAATACATCCCTGAATTCAACCAAATCATTGTAGAGAGGATTTGTCTTGGGCGATTCCCGCGATT
GGGATGTATAACGCTCAATTCGAGTCTTCTCATCAAGGACACTCTCGTCCATTGATGAGCTGCTGGGAACTCGTTCATCTTCGGCAAAAACCATTGCCGA
TCGGATATCACTGACGTACTCATCTTCCGCGACGAGTACGCAGATCTGCTTGAACTTGCCACTACCCAAATCACGGTTTACCGGGGGTAACTGATCTCCG
AAGTTAACTTCGGAGG