Description :
From Genome Similarity Track
Location :
Scaffold_1154:140- 5918
Sequence
5778 bases(100 bases per row)
AAGACTACGCGGAAGAAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCG
CCACCAACAGTTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAA
CGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGAAGCAGAGGATATCTTCGA
GCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCGTCG
CCGAGAATCAGCCAAGCTGCGTCCTCAAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCTGAACCACGACGCATGACTTTAGGACCCTCCG
GGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCGGTGAACGTGAAAGCTCGGGATCCAGTACGCCCTACGCGTGATTTGACACA
ATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGATCCAGTCCCGCCAGTGGAC
CAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGGCACTTCGAAGCTGCGATGAGTCGTTTCCTAGCCGAACAGAGTATGAGAGCGC
CCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGGGAGACAACTCTCATGATGAGTTCGACCCAGACGA
TCTGGATGGCCCATCCACTTCGGCAGCCGTGGTAGCAACAGCCCACACCGGGGCCAGAGGATTGTTCCCTGATTCCGAGGGGCCCGGATTTTCAGCCTTT
GGGCCCTAAAAGATTTCCCCGGCCAGATTGGAAATGAGGACCCGGAGGGAAAACGGGTTCACCCAGATTCAATTTCGGCCTTCTGGGGAGATCAAGCGTC
GGACGTTGAGAAGTGTTTGACCTTTGCGGATTTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGTGGCCGGAT
TTGCTGCGCAGCTTCCAGACCCAGTACTGTAAATTGGGAGTGTCGGTGGCACGACAATACTACCATGATCGCCGCAGATCGGATGAATCCCCGCTGGAAT
ACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCACTTCATCGAGACG
TTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTACGTCTTCCAGACGCAGATGAGCTTAAAGAAGTGCTGCGGGCTGTGGACCGCGCGAAGCACC
GTCACAAGAAGGCGGCGTTTGGATCCGGCAAGTTTTGCCAAAAAGCTCCGACGCGTACGGCTCCAGCTCGTCGTGTCCACCAAGTCACAGCGCCCGGCTC
AGGAACTGAATCGGGATCCGACGGTTCGGACTCCGACCCAGAAGATTACCGCCGAGTCTGTCTCGCTGCACATAACAATCGTACGGCGAAGACCGGAGAC
AACTCTCGATCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACCGCACAAATCAGGTGCTCGCAGTGCGGAT
CCCGGAAGCACACGGAATCTGGATGTTGAAAACATCTGGTCTGTGAGAAGTGCGGCAAGAAAAGGGTCATCTGGAAGATCATTGCTTCTACCTGTGTCGT
GGGGTGTGGCGAAGATTCACGAACGTCGAGCAAGTGTCCGAATGAAGAAATTCTACCACCAGATCCGCCAATGGTTTGACTCAGCCCAGCACCTAGGGGA
TGTTGCCAGAAGTGGCCGAGAAGAGATTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACCAGCCGAGCGTTCTAGGTATTGCATTTATGCATTTGTG
AACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCTGTTGCCAAGGTTTCTAGTTTGCGCC
CAAGTGGATGAATTTGCCAGATCCGAAGTCTCTCCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAACGCCAACCTGGTCGATTGT
TTGAGTCTACCAAAGGTGAGGTCATTGCGGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAAC
AGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAGTCCTACTC
CTAGATAGTGGTGCCGAGGTGTCTATACTAGACACCGCCTTTGCTCGTAAGGTTGGGCGCCAAGTAGATGGGAGTCGGATCCAAGATTGTGTTGGGATTG
GTGAAGGCGTGTGCCGTACGAATGGGAGAACTCGGATCAAGGTCACGCTGGCAGGTTGTTTGGTATACTGGTTCGATATTTGGGTTGGAGATCTCGCTGG
TCAAGACGCCATCCTCGGGATGGATTTCATGGTACCAGCCGGAGTAAAGTTGGATCTGGCGGATGGGACACTATGTTTCCCGGACGAGATGCGGATCCAG
CTCAGCGGACGGCGACCGTTGTACGGGGCGAAGATGAGGATAATAAGGGCAGATAGGACGACCTGGATCGAGCCCGGAGAAACCTGGGAACTGCCATATC
GGTTAAAGTGGATGGAACATGAGCAACTGTGGGTCACACGGGGCGAGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTACCTCCAGGTCACGAACGTC
AGCGACAAGAGACTATTACTGGATCATTATGAGGAGATCGGGCGATGGCTAGCGAAGGACGGTATCTCTAGGCGACCTGGATATGTGTCAGTGGGGTCCC
GTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGGGAGCTCCCGGGGGAGCCAACTGGCCCCTTGGTG
GATCGGCCTTCATGTCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGGAGGTTGGATCCACGACGGGGGACGATCCCC
AGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGAGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGTGGATCCGAGTTT
TCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGTTTAAACTCGTTAGAGGACCGACTAGATCCAACT
GGTGGTTTCCCTGATACCAGGGTACCTGATCCCCCGCAGACAGAAGGACTGCCAGGCGAAAGAGGGTCGCGGTGTTTGGATCCAATGGTGGATCCTACGA
AGACGGAAGATGAGCAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAG
AAGAGGTCACGACTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCT
GATTGGCAAAGGTAATGCATTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGAAAGGTG
GCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAA
TCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGATTACCGGCTGGTTAACGGTCTGAATCGATTGATGGTGTATCCGATGCCTCTAATCAA
TGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACAGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCAATA
TCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCCC
TCTATGGATTCACCCGAATACCGGAACCCAAAAGGGTTGGATCCGGGGAAGATCGTACGGAAGTAGATCCATTTGAGGCAGGGGAGCCAGGGGATCCTGG
AACCCCGTCCGTGTTAGAACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGAGTGACATCCCTACTGGAG
GCGTGTACTAAGTGGAATCTCTCCATCAGTGTGGTAAAGAGCTATTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTGG
AGGCGAATCCTAAGGACCTGTCTTCGTTAGCCGACTTGTCCTTCCCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCG
GTTCATCGAGGATTACGCACTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAA
CAAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGAGATCCAAGTGGTATGACGTCAGAAGAGGACCTAACACAGGAGCTGGATCCACCCCGAGACCAAC
AGAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAGCTGAGGAA
CAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCAGAACGTCAACCTACGGTGATAGGTTATGCCAGTGACTGGGCCGTCTCAGCAGCTCAGGTA
CAAGAACATGAGGGCATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAATTGAACTACGGAGCAGTGGAGAAAGAGATACTCGCGC
TCCTGCGCGTGTTGGATCTGAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACCCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGG
GTTACAAGGACGTTTGGGACAGTGGGCAGCTTTTTGGACACTGGAGATTGTGAAATGTTCGAAGGGGGAAGACGAGATCCTGGGAGTCTTGGCCGCGAGC
ATCACTCCTCGAGCTTAGATGGATGAGGCGCTGACTAGGGTCGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCTATCCCGACGATACAGGTGG
ATGAGGATCTGTACGTCCTGAGTTTCGATGGATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTGCCCGGATGGGAAGT
TGTACGGGCCAGATCCACTTACGCGGAAGGCCTCACCGTCAATGAGGCGGACTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGGGACAAGATCCG
AAAAGGTTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGCGAGATTGACTGCAAGGCCCCGGCC