Description :
From Genome Similarity Track
Location :
Scaffold_2223:140- 2593
Sequence
2453 bases(100 bases per row)
GATGAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATATATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAGAAGGGA
CATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAACCCAGGCAGGTATAGGCTTAAATATCAATACAGACTCCAATTTGC
ACAGTGACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAACTACATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATATAGTGTTGGTAGTG
ATAACTGGATAATACATTGGCCAGATCCTACAGCCTAGTGAGCTTTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTA
CACCCTAGGGGCTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACC
CTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGC
TGCTCCACCCCATCCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGT
ACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTTGTAAGTTGGATCTGGCAATCTCG
CAGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAG
ATTGAGCCAGGGGAAGAGGCGTCGTCGGAAGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGTGTTTTGGGAGGAACTCTG
TCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAAAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCA
AGATCCGCTAACAAAACAAGGAAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAATCCAAGCCCGCTAGTC
GAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCGGGATCCAGGTCAAGCTGGT
CCGACAAGGATCTCGAGTTTATGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCCCGACAGATCGACGA
TCCAAAAGAACCGGTAAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGT
GCGTTCGACGCAGAGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGT
CGCGCACTATGGATCCGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCATCCTCGATCTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACC
ACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCTGTGAGCGCGAAGGCTCGGGATCCA
GTAGGCCCCACGCGTGATCTGACACAATCCAGCCACGATCGAGCCAGATCCGACAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCGCC
TCACGGATCCGGTCTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAACGACACTTCGAAGCTGCGATGAGTCCTTT
CCTGGCCGAACAAGGCATGAGAACGCCCGTGCCGCAAGCACAAGTGTTCTACGAACATGGGGCACGAGACGTGGAAATGGAGTCAGTGGAGGGAGACAAC
TCCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCC
AAAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGC
CCTCATGAGAGATCAAGCGTCGGATGCTGAGAAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGAT
CCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACGGT