Description :
From Genome Similarity Track
Location :
Scaffold_3838:140- 1969
Sequence
1829 bases(100 bases per row)
TTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCGCTTGTGGCACGGGCGTTCTCATACCCTGTTCGGCCAGGA
AACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGCGAGACCGGATCCGTGAG
GCGATTACCTTGAGCTCGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATTACGGGTAGGGCGTACT
GGATCCCGAGCCTTCACGCTCACAGGGACTTCCTGTCCTCGGATCCTCGCCCGTGCTTCCAGCATGGATGCCCTGGAGGGTCCTAAAGTCATGCGTCGTG
GCTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACGCAGCTTGGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGA
CCTTTCTCCGGTGATGGACTTAACTTTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAAGTCTAGCTCGAAGATGTCCTCTGCGTCGAGCACA
CCAGCTACGATGCCTGACTCCGTAAGCAAACGTTATAGATCTTTGACTGCCACCAACTTGCTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGAT
CTTCGATCTGTCGTGGATTCAGGATCCGCATGACAGGATCTTGATGCAGGAAGTCACGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGA
CCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTTGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCG
ACTAGCGGGCTTGGGTTTAGGTACGATGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTT
GACTTACGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGCTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGAC
AGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATC
TTCACTTGAGCATCTTCTTGGGACTCACGGTGAAAAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATC
TGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGT
GTACCCGTCGGTAGGGCGGAATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGCCGAGACGTGGGGATGGGGTGGAGC
AGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTAGCCGTA
GGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAGCCCCTAGGGT
GTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCAATAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTA
TCACTACCAACACTAGATTCGCAATTCCC