Description :
From Genome Similarity Track
Location :
Scaffold_23:140- 1733
Sequence
1593 bases(100 bases per row)
TCCATCACATGAAGATTGAAAATCCCCCAAGTTCAGTCGAAGATTGATTTCCTTGCCATCGATGAGCAAGAAGACGCTCAAGCGTAGCCTAACGAGAGGC
GAAATCTCGCAGATCTGCATGATCGTCGATGTTGACGATGCAGAGGACATCGGCACGGTATCAGCAACGGAAGCTGAAGTGCTCGATGAAAAGACACGGA
AGGAAAGGTTCGAGGAGCAGTCGTGGAACGCTCTCAAGATGAACCCCGTGTATGCACTTGCCAGGGAATTTGAAGACATTTTCCCAGACAAGGTGCCGGA
CGAATTGCCATTTGATAGAGGCATTCGTCACGAGATAGATGTACTTCCGGGAACAAAGTACTGTATCACAAGGCAATGGCCGCTACCGAAGGAACAAGTC
GATGCGATCGATGAGTTCTTCGCGCAGCGACAGAAGGCTGGCCATGTGCGCGAGAGCAAGTCTCCGCACTGTAGTCCCACCTTTTGTGTTAAAAAGGCCA
CAGGCGGTTGGCGCATTGTTCATGCATTCAACAAATTGAATGATGCGACCATACCTGCTCAGACTCCAGTTCCACGAAAGGATATGATCCTTGATGGAAT
GGTTGGCAGCACCGTCTTCAGTGCTATCGATCTGAAAGATGGATTCTATCAGATTCGAATGCGCAAAGACGATGTCCCACTAACTGCAGTGAGTACCCCT
AGCGGTATGCTGTGGGAATGGTTAGTGATGCCACAGGGACTGAAGAATGCACCCGCGACCTTCAATCGAATGGTCACGAACGTTCTTCGTCCTTTGCGAG
CATTTGCACCGAGTTACTTCGACGATATCTTCGTTCATAGTAAGGCCACAAATGGGAGATCTGATGTCGATGTTCATCTTGATCATCTTCGTCAAGTTTT
CCAGGTCATGCGTGAAAACAAACTTTACGCAAACTTGAAGAAGTGCATGTTCTTCGCCCCCGAGATCCCTGTTCTCGGATGTTTTGTGGGCAAGAACGGT
GTTCGAGTTGATCCGGAGAAGGTCAAAGCTATTGACGATTGGCCTGTGCCAAAGAACGTCAAACAGCTACGCCAATGGTTGGGTCTGGCCAACTATTTGC
ACAAGTACACGCGCAATTATGCAGCGTTAGTGCAACCCCTCACACAGCTCTTGAAGAAAGACGTTGAGTGGAAGTGGTCGAAAGACCATCAAACGGCGTT
CGAAGAAGTCAAGAGGAGTCTTCGTGAAGCTCCTGTGTTGGCTCTACCGAATCACGACAAGCCGTTCCACGTCGTCTGTGATGCGAGCGATTATGCCATC
GGTTGCGCATTGATGCAACACGATGATGAGGGTCGAGAGCGAGTTGTTTCGTATCAGTCACGACAACTCAGACCCGCAGAACGGAACTATCCAGTTCACG
ACAAGGAGCTACTGGCAATGAAGTATGCTCTTGTCAAGTTCCGTGTCTATCTGCTTGGCGAGGAGCGCTTTGCGATCTACACAGATCATGCGTCGCTGCG
GACAGCAGTAAAGACTCCTCACTTGTCGCAAAGAATGGCGAGATGGTTCTCCTTCTTTGCGGAGTACAACTTTGTTGTACACTACAAGCCAGG