Description :
From Genome Similarity Track
Location :
Scaffold_2230:140- 1242
Sequence
1102 bases(100 bases per row)
GACGCATTTTGTCGGCAGGACCAGCCAAATGCGTAGAGCCACCATACAAATTCCAAGAGTCGAACTCATTTGTGCCATATCAAGCTGCTGACCGACAGTT
TACATACGAAGTCTAGTCATTCTCAGTCCGCACAAGAAGTCAGTAGTCCAGTCGAGAACAGCAAAAAGCAATAGAACAACAACATGAGTCTCCAAGATCT
GGCACCTGTGAACACGAAGCGAGCATTAGCGACAGCAATAAGCATCTTCGATCAATTTCTTGCGAAGGAAAACGTGACGAGGGAGGTTGTCCAAGCGTCT
CTTCTGGTAGACAGCTGCGGCAATGCGTTTGTAAAGCTCATGGACCGCTTTGCTATGTTTTTACCCTCGTCGAAACGCAAAAGTGGTGAGCCTCGGAAGC
GGGACACAGTGATGAGCTATTATCGGAACGTGAAAAactggctgctggagcgctACCCTCAAGGCCGCGCTAACATCGAGCAGCAACTACTCAAGATGGG
ACGAATATTGGACCGCCATTGCCTTCTCCGGCAAAAGGGAGGCATGATTGACAAAGCTCCTGCGTGTACGAAAGATGACCTGCGCTCGCTCGTAGATGGC
CTATACTACGACGCAGTAGGGGAAACGGAGTACCAAGATGCGGCCTTGTTGGTGGTCATGTGGTACGCATTTGGGAGGGCGTCAGACCTCACATTCATTC
CAAAGTCCAGCCTTTCCTTGTCTGCGGATagcgtcctcttcatccGGCTGATTCGAGCTAAAAGATCCGAAGAACAAGGTCTTTCACTTTTTCCAGACAA
GGACTCGTTCATTACCTGCCCGATTAACGCTATTGCTATGGCGTTAGCCATGCAGACATTTCCAATTGCATCGCTACTTAATCTAGCGTTACCGCCAACC
GATGACGAGACTAACCAGCCAGTCCCCTTGAGCCAGACCCCGCTAATGGACGTGTTACTTCAAAGTTCTGAAGATAGCGAGCATACAGATGCATCAGTGA
GTACTAGGCGGAGCCGCGCGACTCCTCTGAAGCTCCAAGGCTATGTTAATCGTGTCCTGAAAGGAGCGGCAGCTAATCAGACGAAGGGAAATATCACGGA
CA