Description :
From Genome Similarity Track
Location :
scaffold_897:140- 1191
Transcript NameFunction/comments
g10564.t1 hypothetical protein PHYSODRAFT_498449

Sequence
1051 bases(100 bases per row)
GGAAACTCCTTCAGCTCGGAGATCGCAGACATTCGGACGCGGGGGATCACAGACGCGTTCTCAGACGACGTAGTCGTCTCTGCCGAGGCTATAACAGTAC
GGCGTGGGATGTCAATGCTTAAGTCGTCGGGATCGTACTCGTCCGGGGATTCATGGAGCGGTTCCACCGATTCCATGTAAGCAGCCTGCGTCCCCGGTAC
TTTTGGTTGGTCAAGTTTTGTCTCCGCCGCTTGCTCCTTCAGGAATCGTTCCATGGCCGTATTGTAGAACAACGGCACATGACCGAGACTGTGGAGATCG
GGGGTAAACCTAGGTGCCGCCATGGTGTTGACGGACACCTTCTCCTCCTTGATCTTCCTCGCTTGGAGCATGCCAGCGCCGGATGGGCCAAGCGTAATTC
TTGTTGGCTCCATCATGTCGTCCTACTCGACGTCCAAGGAAACGGATGCCTTCGCGGACGCGAATCCTGAGTGCGAGGATGCAGAGGTGGGGTATCCTCA
GTCACGCCTACCAACGGCTTCAGCAGCTTGAACAAGCGTCTGGATGGCTCAGCTCGAATACACTTCCGCATCGAATGCACCAGCGACGATCCCGGCTTCT
TCCAGCATGTTAATCAGGCTGGTGATGGCGACCATGAGGTCGGATGCTTTGGCCGGGGAGGTCACAGGGCCTTGGAGTTCTCCGATCAGCTTCGGCTTCA
TCAATATCATCACGGGATCTTCCAAAAGGAACGTGTTGAGCTGCTTCCGGTAAAAGATCGTCTGCAGCTGCTCCGGAGTCCAGGTCCTGGTTTCTCCACC
CTCGTCCGCGTCTGGTGCCCTCATCATCAGTTTCTTTGGCTTCGTCGTGGACTTCTTATTCGAGGAGGCGCGGGGTGTGGAGGGAGTAGTTGTGGGTGAA
GATCCTTCCGGTTTCACGGATGGATCTTCATCCGGCGGATTGCGATTCGCCCAACGGAGGAGGGTGAGGCTTCTCTTCCAGGTCCACCGCTGAACCTTCG
TCCTATTCCCCGTCAGAGTTCTTCCCAGTACACTGGCGTTCGGTGTATCCT