Description :
From Genome Similarity Track
Location :
Scaffold_13:14- 6611
Transcript NameFunction/comments
Phyca_LT1534563697conserved unknown protein
Phyca_LT153439576ubiquitin fusion degradation protein putative
Phyca_LT153478080ubiquitin fusion degradation protein, putative
Phyca_LT1534505353glycine cleavage system H protein putative

Sequence
6597 bases(100 bases per row)
tgctttcgccttcatgctacatgtagtagcaattggaaggtggtaaattggaactgttggtactgttcgttgctggtaaaccgcccgatcgatgtaggca
tccggagggctggtctggaggtgactgcgcatgttcttgggcgtagccgataacgtgtctccgcagtgcgtacacactacgcgtggagtcttaaacgagc
cagtaggattttttagtgaagtgggcccaaatgccgccgcgcttccggcccatggtgaaaattgtagagtgagttcaccgaaacaaacttcaccagttca
ctgctgagcacgcacatgaagctccaatttccatgtgattacgtgcgagtccctttagcacatgctcatcttatcgccattggcgataaaattcgttctt
aggatacggcaggttcatgctggcgtactaaaagtaatttttaaaatcataaaaaccaataaactaatttaactaaccgatttgttttttaaaacgaaaa
ctcattaaaaaaaccattctataatgctgacgaatacgaccagaattgctgtctgtgtgtccacaatactggcacacaaacagcgtgttcgatactnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnaatg
aagcctgtaattagctgtagtgtaggctactccactgtgaaaaagatctccacgaaatataatagcgtagccgcgaggtgttgcaagtgtcattgtatct
ttggagaatgacacgaaacttcgtgtttttacgggttgtttcgaatatccaagcgtacaaaaagaagtgatattggatggtatcaaaactggaaaatttc
cactcgtgagacagaaaaatgtacgcgacgcgggactcgaacccgcaacccccagattcgaagtctgatacgctatccattgcgccagccgcgctgtgaa
tacttctttttactttgttgtatttaacattattaattaagttcggcagcactcttgattcagccactgaatttcgaactgggcaaaaacactgattagc
tttttacactctgttgctaaggttttaaacaaaaacttgcttagagaacaaggaaaccacctccagaagtctatctcagcccgggaccgataaaaaaaat
gtatccacgacttgattggttgcttattaaatatcagctcgatacgaccttactgaaactaagtaagaaaaatactgttggcagcttaatgaaattcatc
cacaccgaaaacccattacgacactaagtccatgcttcgacgccacaagcgtaaacgtgtggaatctacggccgctgatgacgacgaatgggccatctct
gccgacctcattgacgacaccatggcctccatccaactgctgatgaaccgtaactcggacagctttgcagaactcagcctcccgccagcggtcatctggc
accaattgtaagccttcccttccttttattcaatactgctgctaatgtcttttgagtctgcagatacactctgctaccaaaccggacattcgtcgatcag
aatgtagagcactaatgtcggttcctcctccgacagacggttgactaattcacgctttgccgccactaccaggtgtatcggctgcaaagtgaaggcaagt
tggtgacgtttaagatcccattgggctcggatgaaactgtgatactgcgcgcagaagactacacagctgaggtgaagaagtacgagaatgtgttccgtga
gcaactacgccagcatccgggagacacaactatctccgctaaattaaacgcgatggctacattcggacgagcgttaccgcaactcacctcgttatccact
gctccattggaaatattgctagcacggatgagtgcaagcggtaactgtagtgaagatgacattcgagctatggtggggtacgtctcgtggtaatgtgatg
gtgtagagacacttgagacttacttgtgatttgtgcgcgttgcaattactactgcagacagatccgacgactggggttcttgctgccaacaacgcgctta
gatgacgaagcgtactcattttctgtccctggaataggaaaatttgtgtctgcgattaaaaagactcgatcgctgatcttgagcacgctgaaacgcacca
agtacaaggagatgcatgagcagcagctgaaaaaggcaaagttgaagcattctcgttttcagctggagttccaccttaccgatatggaaggctgtgggtt
aattcgacgaactaaagtcacgtcgggtgtcctagttgcgcttacgaacaaatagacagaaaatgttgtatcatcgatgtctcattagcgacttgtgcac
ttacgtacgagagtcgagctgctcaataacttgaaaccttcgtcgccaaaagttgtgcttcttgccactgtacatctatctcagccgacgaccttggcct
tgaaatgggacagcactctttagctttccattctctttcgtctcctcttctcccttcttctcttcgtcggccaggcttacggcttctccattaagacgct
gtcccactgagtgctctctcttgggagctgtgatagaactgccattggtgttggaggagctaccgttcagagagtatcctccgttgctacttcctcccaa
acgagcgctacctgtgggagcgccgctgaatgcggacgacttaccattaagcgagtgaccagtgccgtggaatgcctcgtacttgcgtaagcgagccgcg
cgaagtgcagctgcatcagtagagctcttctctccacttttctttaagcgcaatcctccgccaaatccacgagtcggcttgacatcgtctgctttcatgg
ttggaacaccttgcatttaaaacagggcattcgtcagtgaatacagagacacataatttactgaagagtcatacctccataaggaacattcgactgtggt
gcaggggggactgcagaggctgcagtagccggcgcaggagggacgtagtcggccggctcctcgaaatctacctcacaatccgtctcaataatgcacgcag
cgggcgcgggtttaacctcacgcacgtccagcaggtagttcttgttattgtacttgaggcaaatagtgtcaccgattgtcatgcacgaaaacttccgaag
agagccctccaaactacataaaacaataagaaatattagttacagcagcgaatacataaccgatcagctccttatgaaacgcacactgcacgaggattgg
agatatccagaaagtcttgtgattgtgggcgaagtttcacgaatgtcgcctttggaagtgacacattctggatgttgagaattccaccttcctttacgaa
aaggttttgcatcatctattgaagatacaagagtaaaaacattagagcaaagcttaatcactgaattaagcaaacttacccagtaaggcatgtagcagct
tccttcaggagcactaaactccaacactccgcagtgcgatgagcggtccactccttcattcgtcaccttaaacagcatcggatactcgatgtgcagacga
gctgaagacataagtggaagaaatatatgagtcccttattccatcatactcgacagcatcatcatcactcttttacctaatgtttccagtgcagaagggg
gcaagagaactacaacagatatcccatcagtcctagccataagaagactgtaacatacaacgtactcttgtcgccatcttctagatgtgccttgtcacag
aacgatacggggtacacgcggtagtgctcgtcgaaactgtaacaaaacattaagatttagtattcgtttccaagaaagtcgaagaacgagaccgtcgcac
cgctgtgggaagtcaccaaagttgaactgcacgccaaaggggttgccatctccaccgaagcctccgaactgccgtcaattaactagtgagttagctgctg
agcgcctacaggagatgccaagaggtcataccattgttcctaggaagtcgactcgtgctaaagggagagaatgataaatgtcgctatgattggatgaaat
tcaacccaatcagacaatcggtctgtcaaaatggctacattgaaggcaacttcaacaattctattgctgccaatcgacatgttgtataggtagatctacg
ttcgaatgctaaggcgcagcttgcgaccttccttggcgagttcttgtgggccgtagccgtcaatgtaagccaggatttgatcttcatcagcgtcgagagg
gatcttgcccgccttcaagtgctgcgagcggcacaatgcaaacacaaacatcagtgcaccattgtcaacatccgtacacatacccagaaaaaactaactt
actcctgtcactgcacgacgcagatccgacgtgaagatgcctggagcaacgctgtaccgaacacagagcttcgttgtgaactgtttcggcagcaaagcgc
cctgacgacccttttcaacaagaccaacacggttttgctcaacgtacgattggttcctgttcttcgtagcgagtttcgactgatcgagttcgtaaagcgc
agcagataactcgtcctcgttaagacgttcgttggcttcgtagcagcgctcaaggtaggcgcgccatcggtccaacttctcttccatgttccagcttctg
gcaacctccgtgtaaattacttcttcgcgaaacttggtcatttccttgtcctcctggtggttcaacaagattctatgcacaagacccttccgctccttcg
ccagcgctgtgtttgggtcctcgtacagtgagacagtgtgaagcttgcctccgaacgagctgctaagaagaacaagtccttcagccggagcaatcggtac
gcgtacgatacggttcgtcactgtagcaatatccatagcatgttagaataaaaagcgccacaaatgacaacaaacgcaacgtacacagagcagcatcgaa
ttccacgcgggacatgcccttcgttgccacagccagtgccccgccaaccatgcaccgaatctggttcaacaagaaagcctggccaacaatgtgcactcgc
aagtgcggttcgccaccgaaatccggcaccagactacccgagcacgagtaaatggagcggcggtgacgcggcaacagcttgcgcgtgagttcctcttcat
cttcaaactgactcgactcctccgagtagtcatctacagtagattcctcctcctcctcgtcgtcaacatcctccgttttttcgatctcgtcgtcagtatc
cacctcgacttcagatttatttcttcgggtttgagccttaaactgcttcctgttcgcgtgcatcttgtagaagtacgacctcgagcgcgtgaagttgtgg
aaatcatggacaccttcatagcgacgtagtgcacggcagaactcagcgacagcttcgtccgtgtcaaagtcttcagcttctggtcccattaggctgtcct
ttaggaacgaaagcggcatgaagtactcgtactcacgcaacacacaattcttgcgtgcagaaaaacgcttgttcactctggtgcaggaaaacactcggat
gttgtccggcagtgttgcatttagagcctccgcaagtccatcgacgcgacccgaaaccggatccaccttgtcctcctcatcaatcagcagcttaccagag
aactacagaagccgaacagaatacacattagcgctgcatatttctctttattgcaacgacaccagaacgtaccacaatgcagccagcgtggacgcccttg
tccgtgcggctgcttctggaccagtcgatcttgcccagatcctcgaaattggactcacgcatagcaccggcctgtaagatggcgcgacgtagctcgtctt
cgatagttgctacgtcgtcgttcatctgcagcccgtggtagcccgtgcccatgtagccgccaacaattgccactttgcgcttgaccagcttggcgggtga
attggtatctgcaggcagatctgcccagttacgccccgttgcaccaccatctccagtagagaaagcggcagaaatactgcgagtgaaggagctacggagc
gccggacgtccgtgacgcagagcaaagcgtgtcaacatgttagcacttgaaccagtggctttcgagtttacaattgtcaggataaagcacttgtttattg
catgctatagttagttaaagtgatgataatgtagccacatcacattggtgaacgcaccacgagcttagaattcactcgacattttgaaaggcacctgaaa
agctctttttctcctagacgctatggctctccgtgtcctctcgcagactctccgtgctcgtgctctgaactcggccactcccgcggcctggcgctcgacc
tcgcagcgtctcgccttcttctcgaccaagtacacgccccagcacgagtacgtgacgatcaacggcaaggagggcaccatcggaatcacggactttgccc
agaactcgctgggcgacgtcgtgtacgtggatctgccgtcggtgggcgacaagtttgccaaggggtaagtttttacggcctggagtttgtgctgtct